Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CzrA in Clostridia-3

Properties
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Regulog: CzrA - Clostridia-3
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides pectinophilus ATCC 43243
BACPEC_01957 PF00403 -87 6.9 CATATGAATGATTGTTCATATG
Bryantella formatexigens DSM 14469
BRYFOR_04019 PF00403 -41 7.6 CATATGAATAAATGTTCATATG
Clostridiales bacterium 1_7_47_FAA
Cbac1_010100022152 czrA -54 6.2 CATATGAACAATCATTCATATG
Clostridium bolteae ATCC BAA-613
CLOBOL_01424 czrA -55 6.2 CATATGAACAATCATTCATATG
Clostridium nexile DSM 1787
CLONEX_04065 cadA -51 5.1 AATATGGTTATATGAACATATG
CLONEX_04065 cadA -35 5.7 CATATGAACAATCACTCATATG
Clostridium scindens ATCC 35704
CLOSCI_04034 cadA -63 7.6 CATATGAATAACTGTTCATATG
Dorea longicatena DSM 13814
DORLON_02327 PF00403 -62 7.3 CATATGAATAACTGTTCATATA
Eubacterium eligens ATCC 27750
EUBELI_01434 PF00403 -63 7.3 CATATGAATGAATGTTCATATG
Eubacterium rectale ATCC 33656
EUBREC_2969 PF00403 -78 6.2 CATATGAACAATCATTCATATG
Roseburia intestinalis L1-82
ROSINTL182_01065 czrA -58 5.6 CATATGAACAGATAAGAATATG
ROSINTL182_01062 cadA -28 6.9 CATATGAATACATGAACATATG
Ruminococcus gnavus ATCC 29149
RUMGNA_00975 cadA -28 6.6 CATATGAACAGCTATTCATGTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD