Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SdaR in Vibrionales

Properties
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Regulog: SdaR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Photobacterium profundum SS9
PBPRA3189 grtP -171 6.7 GATTGTGCAAATGCACAATT
Vibrio cholerae O1 biovar eltor str. N16961
VCA0904 grtP -158 6.4 AATTGTGCATCTGCACAGTT
Vibrio fischeri ES114
VF_2156 grtP -121 6.6 ATTTGTGCAATTGCACAATG
Vibrio harveyi ATCC BAA-1116
VIBHAR_06863 garK -144 6.5 AATTGTGCAAGTGCACAAAA
Vibrio parahaemolyticus RIMD 2210633
VPA0116 grtP -158 6.8 TATTGTGCATTTGCACAATA
Vibrio salmonicida LFI1238
VSAL_I2593 grtP -121 6 CTTTGTGCATCTACACAATA
Vibrio vulnificus CMCP6
VV1_1655 grtP -129 6.5 AATTGTGCAGATGCACAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD