Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GudR in Comamonadaceae

Properties
Regulator family: LacI
Regulation mode:
Biological process: Glucarate utilization
Effector:
Regulog: GudR - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Methylibium petroleiphilum PM1
Mpe_A0968 gudR -36 5.5 GGATGGTAGCGGTGTCATCT
Mpe_A0969 tctC4 -73 6 GAACGGTAGCGCTACCATTT
Mpe_A0969 tctC4 -51 4.8 AGACGATAGCGCTACCAGAT
Acidovorax avenae subsp. citrulli AAC00-1
Aave_3625 gudR -110 5.9 GGATGTTAACGTTAACATCC
Aave_3624 tctC4 -40 5.9 GGATGTTAACGTTAACATCC
Polaromonas sp. JS666
Bpro_4527 gudR -24 4.9 GCAAGTTAGCGTTAACATCA
Bpro_3418 gudR -33 5.2 GACTGGTAGCGCTATCGTCG
Bpro_4526 tctC -79 5.9 AATTGTTAGCGCTAACATTC
Bpro_3419 kdgD -29 6 AAAAGGTAGCGCTACCATTC
Bpro_3419 kdgD -2 5.5 CAATGGTAGCGCTACCTTTA
Polaromonas naphthalenivorans CJ2
Pnap_1130 gudD -93 5.7 AAATGTTACCGATAACATTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD