Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator QorR in Streptomycetaceae

Properties
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Regulog: QorR - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces coelicolor A3(2)
SCO4014 qorR -38 5.5 GCACTCACTCATGGTGAGCGC
SCO4593 qorD -69 5.2 GCACTATCCTCTGGTTAGCGC
Streptomyces avermitilis MA-4680
SAV_4875 qorR -44 6 GCACTAACTCAGCGAAAGTAC
SAV_4874 qorD -66 6 GTACTTTCGCTGAGTTAGTGC
Streptomyces griseus subsp. griseus NBRC 13350
SGR_2932 qorD -103 5.8 GTACTTTCCCATAGTTAGCGC
SGR_2931 qorR -44 5.8 GCGCTAACTATGGGAAAGTAC
Streptomyces scabiei 87.22
SCAB_37581 qorR -44 5.9 GCGCTAACTCTGCGAAAGTAC
SCAB_37591 qorD -68 5.9 GTACTTTCGCAGAGTTAGCGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD