Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AmtR in Mycobacteriaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Regulog: AmtR - Mycobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Mycobacterium smegmatis str. MC2 155
MSMEG_2184 uctT -60 6.6 GTTATCTGTCATCTGACAGGTAAG
Mycobacterium abscessus ATCC 19977
MAB_4090 uctT -101 5.9 TTTACCTATCGCCTGACAGATATT
MAB_4089c amtR -183 5.9 AATATCTGTCAGGCGATAGGTAAA
Mycobacterium sp. JLS
Mjls_1819 amt1 -116 5.4 AAAACCTGTCACATGACAGACACA
Mjls_1819 amt1 -21 6.2 GAAAACTGTCAGGTGACAGAAATG
Mjls_1823 amtR -67 6.3 CGTTTCTGTCGTGTGACAGAAACC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD