Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator QorR in Micrococcineae

Properties
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Regulog: QorR - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Arthrobacter chlorophenolicus A6
Achl_0581 qorB -94 5.8 AGTACCTTACTTCAAAGTGCG
Achl_0580 qorR -62 5.8 CGCACTTTGAAGTAAGGTACT
Clavibacter michiganensis subsp. michiganensis NCPPB 382
CMM_2832 qorR -34 4.6 CCCACTTTCTGGTAAGTTGTG
Janibacter sp. HTCC2649
JNB_06534 qorB -39 5.9 CGTACCTTACTTCAAAGTGGG
JNB_06539 qorR -42 5.9 CCCACTTTGAAGTAAGGTACG
Kocuria rhizophila DC2201
KRH_16940 qorB -92 4.6 AGTGCCTTACTGCGAAGTGCG
KRH_16940 qorB -35 4.5 TGTACCTTCCGTCAAGGACCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD