Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PaaR in Frankineae/Propionibacterineae/Pseudonocardiaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidothermus cellulolyticus 11B
Acel_1443 paaA -41 5.7 GTCAACCGAACATTCGGTCGGT
Acel_1435 paaZ -177 5.3 GCCGACCGAACGTTCGGTCTAG
Nakamurella multipartita DSM 44233
Namu_2491 paaA -70 5.6 TCTTACTGACCGTTCGGTCAGT
Namu_2491 paaA -66 5 ACTGACCGTTCGGTCAGTTACA
Namu_2483 paaR -43 6 ACTGACCGAATGATCGGTCAGC
Saccharomonospora viridis DSM 43017
Svir_26540 paaZ -39 5.3 ACTTCCTGAACGTTCGGTTGGT
Svir_26560 paaI -42 5.6 AGTAACCGTCCATTCGGTCAGT
Svir_26550 paaH -116 5.6 ACTGACCGAATGGACGGTTACT
Saccharopolyspora erythraea NRRL 2338
SACE_3543 paaZ -186 5.5 ACTGACCGAGTAGTCGGTTATT
SACE_3543 paaZ -52 5.5 CGTTACCGAACGAACGGTCGGT
SACE_3543 paaZ -48 5.4 ACCGAACGAACGGTCGGTAAAA
SACE_3542 paaK -232 5.4 TTTTACCGACCGTTCGTTCGGT
SACE_3542 paaK -228 5.5 ACCGACCGTTCGTTCGGTAACG
SACE_3542 paaK -94 5.5 AATAACCGACTACTCGGTCAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD