Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator QorR in Frankineae/Propionibacterineae/Pseudonocardiaceae

Properties
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Regulog: QorR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Saccharopolyspora erythraea NRRL 2338
SACE_0812 qorR -47 4.8 ACGGTATCGATTGGTAACCAG
SACE_0813 qorB -51 4.8 CTGGTTACCAATCGATACCGT
Frankia sp. EAN1pec
Franean1_1881 qorR -34 5.3 CGGTTACCTCCCGGATAGCGG
Franean1_1882 qorB -89 5.3 CCGCTATCCGGGAGGTAACCG
Frankia sp. CcI3
Francci3_2019 qorR -42 5.8 CGGTTACCGCGGGGATACCGG
Francci3_2018 qorB -87 5.8 CCGGTATCCCCGCGGTAACCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD