Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AmtR in Nocardiaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Regulog: AmtR - Nocardiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Nocardia farcinica IFM 10152
nfa22220 uctT -51 6.4 CAAAACTATCAACCGACAGATATT
nfa22230 amtR -160 6.7 AATATCTGTCGGTTGATAGTTTTG
Rhodococcus erythropolis PR4
RER_29520 uctT -58 6.9 GAAAACTATCAATCGACAGTTATT
RER_29510 amtR -172 7.1 AATAACTGTCGATTGATAGTTTTC
Rhodococcus opacus B4
ROP_68870 amtR -171 7.2 AATATCTGTCGATCGATAGTTTTC
ROP_68880 uctT -47 6.9 GAAAACTATCGATCGACAGATATT
Rhodococcus sp. RHA1
RHA1_ro06918 amtR -170 7 AATATCTGTCGCTCGATAGTTTTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD