Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MntR in Clostridia-1

Properties
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium acetobutylicum ATCC 824
CAP0063 mntH -78 6.2 AAATTTAGTTTAATCTAACTTT
Clostridium beijerincki NCIMB 8052
Cbei_4069 mntR -133 6 TTTCTTAGCCTAGTCTAAATTA
Cbei_4070 mntH -109 6 TAATTTAGACTAGGCTAAGAAA
Clostridium novyi NT
NT01CX_2309 mntR -164 6.8 AAAATTAGCTTAGTCTAACTTT
NT01CX_2308 feoA -65 6.8 AAAGTTAGACTAAGCTAATTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD