Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SdaR in Clostridia-1

Properties
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Regulog: SdaR - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium butyricum 5521
CBY_1134 grtP -120 6.4 AATTGTTCAAATGCACAAAA
Clostridium acetobutylicum ATCC 824
CAC2835 grtP -119 6.6 TTTTGTGCAATTGAACAAAA
Clostridium beijerincki NCIMB 8052
Cbei_4480 grtP -152 6.4 TATTGTTCAAATACACAAAA
Clostridium novyi NT
NT01CX_0983 grtP -97 6.4 TATTGTGCATTTGAACAATA
Clostridium perfringens ATCC 13124
CPF_0853 grtP -135 5.7 CTTTGTGCGTTTGCATAAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD