Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AmtR in Micrococcineae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Regulog: AmtR - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Arthrobacter aurescens TC1
AAur_0190 uctT -90 4.9 GAAAACTATCAAGTGACCGATATT
AAur_0192 amtR -162 4.9 AATATCGGTCACTTGATAGTTTTC
Arthrobacter sp. FB24
Arth_3665 amtR -163 4.8 AATACCGGTCACTTGATAGTTTTC
Arth_3666 uctT -93 4.8 GAAAACTATCAAGTGACCGGTATT
Clavibacter michiganensis subsp. michiganensis NCPPB 382
CMM_0123 uctT -87 5.2 AATACCTATCGCTCGATAGATACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD