Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SdhR in Comamonadaceae

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Tricarboxylic acid cycle
Effector:
Regulog: SdhR - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_2206 mdh -156 7 CATCATATCTTATATAAGACATAAGA
Aave_2205 sdhR -20 7 TCTTATGTCTTATATAAGATATGATG
Aave_2860 aceA -115 7.5 TTTTATGTCTTATATAAGACATAAGA
Acidovorax sp. JS42
Ajs_2401 aceA -115 6.9 ATTTATCTCTTATATAAGACATAAGA
Ajs_2791 mdh -91 7.2 GATCATATCTTATATAAGACATAAGA
Ajs_2792 sdhR -4 7.2 TCTTATGTCTTATATAAGATATGATC
Comamonas testosteroni KF-1
CtesDRAFT_0622 mdh -155 7.2 GATCATATCTTATATAAGACATAAGA
CtesDRAFT_0860 aceA -109 6.1 ATTTCAGTCTTTTATAAGACATAAGA
CtesDRAFT_0621 sdhR -4 7.2 TCTTATGTCTTATATAAGATATGATC
Delftia acidovorans SPH-1
Daci_2429 mdh -157 7.2 GATCATATCTTATATAAGACATAAGA
Daci_2428 sdhR -87 7.2 TCTTATGTCTTATATAAGATATGATC
Daci_4617 aceA -1 5.3 GATGAGGTCTTCTATAAGACTTAAAT
Daci_4617 aceA -31 5.9 AATTTAGTCTTGTATAAGACACAAGA
Leptothrix cholodnii SP-6
Lcho_2708 mdh -175 7.5 ACAGATGTCTTATATAAGACATAAGA
Lcho_2711 acnB -114 6.1 TGGCAAGTCTTATATAAGACATAAAA
Lcho_1744 aceA -102 7.1 ATTTATATCTTATATAAGACATAAGT
Lcho_2707 sdhR -73 7.5 TCTTATGTCTTATATAAGACATCTGT
Methylibium petroleiphilum PM1
Mpe_A2172 mdh -152 7.4 AAAGATGTCTTATATAAGACATAAGA
Mpe_A1889 aceA -103 6 ATAGAAGTCTTATATAAGATAGAAGT
Mpe_A2171 sdhR -74 7.4 TCTTATGTCTTATATAAGACATCTTT
Polaromonas naphthalenivorans CJ2
Pnap_3031 sdhR -38 7.4 TCTTATGTCTTATATAAGATATGATT
Pnap_3030 mdh -202 7.4 AATCATATCTTATATAAGACATAAGA
Pnap_2855 aceA -91 6.5 TAAATAGTCTTATATAAGACATAAGA
Polaromonas sp. JS666
Bpro_3598 mdh -239 7.5 TATCATATCTTATATAAGACATAAGA
Bpro_2101 aceA -102 7.1 ATTTTTGTCTTATATAAGACATAAGA
Bpro_3599 sdhR -49 7.5 TCTTATGTCTTATATAAGATATGATA
Rhodoferax ferrireducens DSM 15236
Rfer_1335 aceA -124 6.7 AAAAATGTCTTCTATAAGACATAAGA
Rfer_1802 sdhR -23 6.7 TCTTATGTCTTATATAAGATAAGATG
Rfer_1803 mdh -138 6.7 CATCTTATCTTATATAAGACATAAGA
Rfer_1335 aceA -94 5.3 TTTTTAGTCTTATACAAGACCTAAAA
Variovorax paradoxus S110
Vapar_1431 sdhR -4 6.8 TCTTATGTCTTATATAAGATATGCTC
Vapar_1432 mdh -151 6.8 GAGCATATCTTATATAAGACATAAGA
Vapar_1869 aceA -97 7.1 AAATATGTCTTCTATAAGACATAAGA
Verminephrobacter eiseniae EF01-2
Veis_4356 mdh -199 7.2 GATCATATCTTATATAAGACATAAGA
Veis_3088 aceA -116 6.4 TTTCATCTCTTCTATAAGACATAAGA
Veis_4355 sdhR -33 7.2 TCTTATGTCTTATATAAGATATGATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD