Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator TsrR in Shewanellaceae

Properties
Regulator family: [Other]
Regulation mode:
Biological process: Thiosulfate reduction
Effector: Thiosulfate
Regulog: TsrR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella halifaxensis HAW-EB4
Shal_0567 tsrA -287 4.7 CTTTTTTGCGATTCAAAAAACG
Shal_0567 tsrA -257 6 TGATTTTTATATCTAAAAAGAT
Shal_0551 tsrA -263 5.5 ATCCTTTTAGATGTCAAAAGGT
Shal_0550 ccmF-2 -314 5.5 ACCTTTTGACATCTAAAAGGAT
Shewanella loihica PV-4
Shew_0347 ccmF-2 -169 6.2 GCATTTTTAGATCTCAAAAAAG
Shew_0347 ccmF-2 -139 5.4 GCTTTTTGAGTTATGAAAAATA
Shew_0348 tsrA -320 5.4 TATTTTTCATAACTCAAAAAGC
Shew_0348 tsrA -290 6.2 CTTTTTTGAGATCTAAAAATGC
Shewanella oneidensis MR-1
SO0478 ccmF-2 -281 6.9 GTTTTTTTAGATCTAAAAAAAC
SO0479 tsrA -250 6.9 GTTTTTTTAGATCTAAAAAAAC
Shewanella pealeana ATCC 700345
Spea_0503 tsrA -259 6 TGATTTTTATATCTAAAAAGAT
Spea_0478 ccmF-2 -316 4.8 GCATTTTTTGATATCTAAAAAG
Spea_0478 ccmF-2 -314 6.3 ATTTTTTGATATCTAAAAAGAC
Spea_0503 tsrA -289 5.4 CTTTTTTGCGATTTAAAAAACG
Spea_0479 tsrA -264 6.3 GTCTTTTTAGATATCAAAAAAT
Spea_0479 tsrA -262 4.8 CTTTTTAGATATCAAAAAATGC
Shewanella piezotolerans WP3
swp_4658 ccmF-2 -258 6.4 TTATTTTTAGATCTAAAAAAAG
swp_4657 tsrA -366 6.4 CTTTTTTTAGATCTAAAAATAA
Shewanella putrefaciens CN-32
Sputcn32_3365 ccmF-2 -334 6 TGTTTTTTAGAAGTAAAAAAGC
Sputcn32_3365 ccmF-2 -313 5.8 CCTGTTTTAGTTATAAAAAAAA
Sputcn32_3364 tsrA -253 5.8 TTTTTTTTATAACTAAAACAGG
Sputcn32_3364 tsrA -232 6 GCTTTTTTACTTCTAAAAAACA
Shewanella sediminis HAW-EB3
Ssed_0482 tsrA -254 6.1 ATCCTTTTAGATCTAAAAAACA
Ssed_0493 tsrA -256 5.3 CGATTTTTATTTCTAAAATGAT
Ssed_0493 tsrA -132 4.9 TGTTTTTTATATGGAAAATAGA
Ssed_0481 ccmF-2 -314 6.1 TGTTTTTTAGATCTAAAAGGAT
Shewanella sp ANA-3
Shewana3_0488 ccmF-2 -284 6.4 GGCTTTTTAGATCTAAAAAGAG
Shewana3_0489 tsrA -253 6.4 CTCTTTTTAGATCTAAAAAGCC
Shewanella sp MR-4
Shewmr4_0487 ccmF-2 -315 6.4 GTTTTTTGAGATATAAAAAGAC
Shewmr4_0488 tsrA -253 6.4 GTCTTTTTATATCTCAAAAAAC
Shewanella sp MR-7
Shewmr7_3543 ccmF-2 -316 6.4 GGTTTTTGAGATCTAAAAAGAC
Shewmr7_3542 tsrA -253 6.4 GTCTTTTTAGATCTCAAAAACC
Shewanella sp W3-18-1
Sputw3181_0576 ccmF-2 -334 6 TGTTTTTTAGAAGTAAAAAAGC
Sputw3181_0576 ccmF-2 -313 5.8 CCTGTTTTAGTTATAAAAAAAA
Sputw3181_0577 tsrA -253 5.8 TTTTTTTTATAACTAAAACAGG
Sputw3181_0577 tsrA -232 6 GCTTTTTTACTTCTAAAAAACA
Shewanella woodyi ATCC 51908
Swoo_4456 tsrA -258 5.8 CAGTTTTTAGATCTAAAAAATC
Swoo_4456 tsrA -134 4.9 TGTTTTTTATATGGAAAATACT
Swoo_4477 tsrA -265 5.7 AACCTTTTAGATATCAAAAAAC
Swoo_4478 ccmF-2 -320 5.7 GTTTTTTGATATCTAAAAGGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD