Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PhrR in Shewanellaceae

Properties
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Blue light; Adenosylcobalamin
Regulog: PhrR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO3386 COG3272 -70 6.6 TGTACAAAAACTTGATCCTTGTACA
SO3386 COG3272 -18 4.8 GATACAAGGAATCTCATTATGTACA
SO3420 SO3420 -70 6.5 AGTACATTAAGTTAATTTGTGTACA
Shewanella putrefaciens CN-32
Sputcn32_2716 COG3272 -70 6.8 TGTACAAAAACTTGATCTTTGTACA
Sputcn32_2716 COG3272 -18 5.5 TATACAAGGAGTCAGATTATGTATA
Sputcn32_2738 SO3420 -70 6.4 AGTACATCAAGTTAATTTGTGTACA
Shewanella sp W3-18-1
Sputw3181_1296 COG3272 -70 6.8 TGTACAAAAACTTGATCTTTGTACA
Sputw3181_1296 COG3272 -18 5.5 TATACAAGGAGTCAGATTATGTATA
Sputw3181_1274 SO3420 -70 6.4 AGTACATCAAGTTAATTTGTGTACA
Shewanella sp ANA-3
Shewana3_1164 COG3272 -70 6.6 TGTACAAAAACTTGATCCTTGTACA
Shewana3_1164 COG3272 -18 5.5 GATACAAGGAATAGCATTATGTACA
Shewana3_1135 SO3420 -70 6.4 AGTACATTGAGTTAATTTGTGTACA
Shewanella sp MR-4
Shewmr4_1163 COG3272 -70 6.6 TGTACAAAAACTTGATCCTTGTACA
Shewmr4_1163 COG3272 -18 5.5 GATACAAGGAATAGCATTATGTACA
Shewmr4_1134 SO3420 -70 6.4 AGTACATTGAGTTAATTTGTGTACA
Shewanella sp MR-7
Shewmr7_1234 COG3272 -70 6.6 TGTACAAAAACTTGATCCTTGTACA
Shewmr7_1234 COG3272 -18 5.5 GATACAAGGAATAGCATTATGTACA
Shewmr7_1205 SO3420 -70 6.4 AGTACATTGAGTTAATTTGTGTACA
Shewanella baltica OS155
Sbal_3056 COG3272 -70 6.4 TATACAAAAACTTGATCCTTGTACA
Sbal_3056 COG3272 -18 5.3 GATACAAGGAGTCGACTTATGTACA
Sbal_1223 SO3420 -70 6.4 AGTACATCAAGTTAATTTGTGTACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD