Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CblR in Halobacteriales

Properties
Regulator family:
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector:
Regulog: CblR - Halobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Haloarcula marismortui ATCC 43049
rrnAC3005 cbiH -20 5.5 AGTACAAGCACAATTGTTTT
rrnAC2998 cbiT -46 5.7 AATACAACCAAAATTGTTTT
rrnAC3018 chlID -9 5.9 AATACAAGTATGGTTGTATT
rrnAC3016 cbtB -39 5.1 TTTACAATCTTACTTGTTCT
rrnAC3015 cbtA -245 5.1 TTTACAATCTTACTTGTTCT
rrnAC3019 cobN -46 5.9 AATACAACCATACTTGTATT
rrnAC3023 cbiD-II -37 5.4 AAAACAACTCAGCTTGTTTT
Halobacterium salinarum R1
OE3207F cbiT -45 5.6 AATACAATCAAAATTGTTTT
OE3242F cobT -120 4.8 AACCCAACTGTGGTTGCATA
OE3229R chlID -9 5.5 ATTACAACTATGGTTGATTT
OE3239R cbiD-II -44 4.8 TATGCAACCACAGTTGGGTT
OE3230F cobN -45 5.5 AAATCAACCATAGTTGTAAT
OE4346R nrdA1 -153 4.9 TGATCAACTTAGATTGTACT
OE4346R nrdA1 -133 4.6 TCTACAAGTTTAGTTGGTAA
OE3319R cbiM -69 5.2 AATACAAATTCAGTTGTTCT
Halobacterium sp. NRC-1
VNG1550G cbiT -45 5.6 AATACAATCAAAATTGTTTT
VNG1572C cobT -219 4.8 AACCCAACTGTGGTTGCATA
VNG1565G chlID -9 5.5 ATTACAACTATGGTTGATTT
VNG1570H cbiD-II -44 4.8 TATGCAACCACAGTTGGGTT
VNG1566G cobN -240 5.5 AAATCAACCATAGTTGTAAT
VNG2384G nrdA1 -153 4.9 TGATCAACTTAGATTGTACT
VNG2384G nrdA1 -133 4.6 TCTACAAGTTTAGTTGGTAA
VNG1635G cbiM -69 5.2 AATACAAATTCAGTTGTTCT
Haloferax volcanii DS2
HVO_B0062 cbiT -123 5.1 AGAACAAGCGAGATTGTGTT
HVO_B0062 cbiT -150 5 AAACCAAGCACAGTTGTAAA
HVO_B0062 cbiT -47 5.4 ACAACAAGCACAATTGTTTT
HVO_B0064 cbtA -227 5 TTTACAACTGTGCTTGGTTT
HVO_B0063 cbtB -142 5.4 AAAACAATTGTGCTTGTTGT
HVO_B0063 cbtB -66 5.1 AACACAATCTCGCTTGTTCT
HVO_B0063 cbtB -39 5 TTTACAACTGTGCTTGGTTT
Halomicrobium mukohataei DSM 12286
Hmuk_0145 VNG1577C -32 4.6 AGTTCAAGTGTGCTTGCGGT
Hmuk_2791 btuF -60 4.1 GTTCCAACCACAGTTGGGAT
Hmuk_1874 cbiT -46 5.7 AAAACAACCAAAATTGTTTT
Hmuk_1860 chlID -9 5.5 AATACAAGCATGATTGATTT
Hmuk_1861 cbtB -38 4.7 TTTACAATCTAGTTTGTACT
Hmuk_1862 cbtA -229 4.7 TTTACAATCTAGTTTGTACT
Hmuk_1859 cobN -45 5.5 AAATCAATCATGCTTGTATT
Hmuk_2792 btuC -21 4.1 ATCCCAACTGTGGTTGGAAC
Hmuk_1856 cbiD-II -36 5 AGTACAACTACACTTGTACC
Hmuk_1856 cbiD-II -56 4.7 ATAGCAAGCACAATTGGTGT
Hmuk_3351 nrdR -136 4.9 TAATCAAGTCTAATTGTACT
Haloquadratum walsbyi DSM 16790
HQ1628A btuF -64 4.6 TATACAAACGCACTTGCAGT
HQ1834A cbiT -47 5.3 AGAGCAAGCGTAATTGTTTT
HQ1834A cbiT -113 5.5 AAAACAATTTTGCTTGTACT
HQ3035A cbiG -107 5.3 AAGACAACCGTAATTGTTTT
HQ2295A chlID -18 4.2 AGTGCAAAAAAGGTTGATAT
HQ2298A cbiJ -236 4.3 GTTGCAACCCCGGTTGGATT
HQ2296A cobN -45 4.2 ATATCAACCTTTTTTGCACT
HQ1627A btuC -26 4.6 ACTGCAAGTGCGTTTGTATA
HQ1835A cbiM -126 5.3 AAAACAATTACGCTTGCTCT
HQ1835A cbiM -60 5.5 AGTACAAGCAAAATTGTTTT
Halorhabdus utahensis DSM 12940
Huta_2494 btuF -59 4.6 ACGACAAGTTGAGTTGCATT
Huta_2493 btuC -1 4.6 AATGCAACTCAACTTGTCGT
Huta_2339 nrdR -133 5.1 AGTACAACTGAACTTGGACT
Halorubrum lacusprofundi ATCC 49239
Hlac_3478 cbiT -46 5 AGCTCAACCAAAATTGTTTT
Hlac_0880 btuF -58 4.3 TCTCCAACAAAACTTGTAGT
Hlac_3464 cbtA -229 4.9 TTTACAAGCTCAGTTGTGTT
Hlac_3463 cbtB -39 4.9 TTTACAAGCTCAGTTGTGTT
Hlac_3462 chlID -9 5.4 ACTACAACCATGGTTGATTT
Hlac_3458 cbiD-II -33 4.4 AGATAAAGTATAGTTGAACT
Hlac_3461 cobN -45 5.4 AAATCAACCATGGTTGTAGT
Hlac_2946 nrdR -136 5.5 AATACAAGTTTAGTTGTGTT
Hlac_0881 btuC -24 4.3 ACTACAAGTTTTGTTGGAGA
Haloterrigena turkmenica DSM 5511
Htur_0996 cbiT -46 4.9 ATACCAAACAAAATTGTTTT
Htur_0996 cbiT -66 4.4 TGAGCAAGCGAACTTGCCTT
Htur_1830 btuF -58 4.7 GATCCAACCACGGTTGGTTT
Htur_5160 cbtB -37 5.3 TTTACAACTATACTTGTTCT
Htur_5161 cbtA -229 5.3 TTTACAACTATACTTGTTCT
Htur_1006 chlID -9 4.6 AGCGCAACTATGGTTGCAGA
Htur_1005 cobN -45 4.6 TCTGCAACCATAGTTGCGCT
Htur_1831 btuC -21 4.7 AAACCAACCGTGGTTGGATC
Natrialba magadii ATCC 43099
Nmag_1837 btuF -58 4.9 AATGCAACTCTGATTGCAAT
Nmag_3175 cbiA -115 4.4 AGTTCAAGTACAGTTGTGTG
Nmag_3605 btuF -58 5 TGTGCAAGCATGATTGCTTT
Nmag_2658 nrdR -136 4 AACACAAGTGAATTTTCACT
Nmag_3606 btuC -22 5 AAAGCAATCATGCTTGCACA
Natronomonas pharaonis DSM 2160
NP0736A cobT -33 4.1 GGTTCAAGTACACTTGTCCA
NP0736A cobT -97 4.4 ACAGCAATTCGGCTTGTACA
NP3814A btuF -57 4.2 GCTGCAACTGGGCTTGGTTT
NP1116A cbiH -101 5.2 ACAACAAGCACAATTGTTAT
NP1124A cbiT -46 5.3 AGCACAACCAAAATTGTTTT
NP0736A cobT -117 5.4 TAATCAAGTATAGTTGTATT
NP1094A chlID -29 4 TGATAAACTCCGGTTGTTCT
NP1094A chlID -9 4.6 AATACAACCGTGATTGACAA
NP1092A cobN -45 4.6 TTGTCAATCACGGTTGTATT
NP1092A cobN -25 4 AGAACAACCGGAGTTTATCA
NP3816A btuC -21 4.2 AAACCAAGCCCAGTTGCAGC
NP0734A cbiD-II -27 5.4 AATACAACTATACTTGATTA
NP0734A cbiD-II -47 4.4 TGTACAAGCCGAATTGCTGT
NP6162A nrdR -117 4.3 ACACCAATTTTATTTGGAAA
NP6162A nrdR -137 5 AAATCAAGTTCATTTGTACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD