Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SO1758 in Shewanellaceae

Properties
Regulator family: [Other]
Regulation mode: repressor
Biological process:
Effector:
Regulog: SO1758 - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_1756 SO1756 -104 6.8 ACTGACATGATGCTGTCAGT
Shewanella putrefaciens CN-32
Sputcn32_1455 SO1756 -122 7 ACTGACATCATGCTGTCAGT
Shewanella sp W3-18-1
Sputw3181_2647 SO1756 -122 7 ACTGACATCATGCTGTCAGT
Shewanella sp ANA-3
Shewana3_2706 SO1756 -110 6.7 ACTGACATGATGTTGTCAGT
Shewanella sp MR-4
Shewmr4_2540 SO1756 -110 6.7 ACTGACATGATGTTGTCAGT
Shewanella sp MR-7
Shewmr7_2607 SO1756 -110 6.7 ACTGACATGATGTTGTCAGT
Shewanella baltica OS155
Sbal_1562 SO1756 -121 7 ACTGACATCATGCTGTCAGT
Shewanella amazonensis SB2B
Sama_1190 SO1756 -114 6.4 GCTGACACCATGTTGTCAGC
Shewanella loihica PV-4
Shew_2543 SO1756 -105 6.5 ACTGACACTAGGCTGTCAGT
Shewanella sediminis HAW-EB3
Ssed_2787 SO1756 -71 6.5 ACTGACACTACGCTGTCAGT
Shewanella woodyi ATCC 51908
Swoo_3144 SO1756 -100 6.8 ACTGACACTATGGTGTCAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD