Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SdaR in Shewanellaceae

Properties
Regulator family: SdaR
Regulation mode: repressor
Biological process: Glycerate utilization
Effector: Glycerate
Regulog: SdaR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO1771 grtP -197 6.5 TTTTGTGCTCATGCACAAAA
Shewanella putrefaciens CN-32
Sputcn32_1471 grtP -190 6.8 TTTTGTGCGCACGCACAAAA
Shewanella sp W3-18-1
Sputw3181_2630 grtP -190 6.8 TTTTGTGCGCACGCACAAAA
Shewanella sp ANA-3
Shewana3_2684 grtP -199 6.8 TTTTGTGCGCACGCACAAAA
Shewanella sp MR-4
Shewmr4_2518 grtP -200 6.7 TTTTGTGCACACGCACAAAA
Shewanella sp MR-7
Shewmr7_2586 grtP -200 6.7 TTTTGTGCACACGCACAAAA
Shewanella baltica OS155
Sbal_1576 grtP -204 6.6 TTTTGTGCGTGAGCACAAAA
Shewanella frigidimarina NCIMB 400
Sfri_2641 grtP -131 6 AGTTGTGCGTGTGCACAAAT
Shewanella loihica PV-4
Shew_2533 grtP -199 5.4 ATTTGGGCAAAAGCACAAAT
Shewanella pealeana ATCC 700345
Spea_2713 grtP -190 6.6 TATTGTGCGCACGCACAAAA
Shewanella halifaxensis HAW-EB4
Shal_2799 grtP -190 5.9 AACTGTGCGCACGCACAATA
Shewanella piezotolerans WP3
swp_3291 grtP -190 5.8 AACTGTGCACGCGCACAAAT
Shewanella sediminis HAW-EB3
Ssed_2778 grtP -203 6.7 TTTTGTGCATACGCACAAAA
Shewanella woodyi ATCC 51908
Swoo_3133 grtP -155 6.3 TATTGTGCATGCGCACAATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD