Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HisR in Xanthomonadales

Properties
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Regulog: HisR - Xanthomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Stenotrophomonas maltophilia K279a
Smlt2162 hisG -384 7.2 TGTACTAACGCGCTATTACA
Smlt2161 hisR -23 7.2 TGTACTAACGCGCTATTACA
Xanthomonas axonopodis pv. citri str. 306
XAC1827 hisR -28 7.3 TGTACTAACACGCTATTACA
XAC1828 hisG -364 7.3 TGTACTAACACGCTATTACA
Xanthomonas campestris pv. campestris str. ATCC 33913
XCC1808 hisG -364 7.3 TGTACTAACACGCTATTACA
XCC1807 hisR -28 7.3 TGTACTAACACGCTATTACA
Xylella fastidiosa 9a5c
XF2221 hisR -27 6.2 TGTAATAGTTCGCTATATCA
XF2220 hisG -362 6.2 TGTAATAGTTCGCTATATCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD