Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HisR in Listeriaceae

Properties
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Regulog: HisR - Listeriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Listeria innocua Clip11262
lin0578 hisZ -55 6.1 CACTTTAACGTGCTAATATG
lin0579 hisJ -116 6.1 CATATTAGCACGTTAAAGTG
Listeria monocytogenes EGD-e
lmo0569 hisZ -55 6.1 CGCTTTAACGTGCTAATATG
lmo0570 hisJ -116 6.1 CATATTAGCACGTTAAAGCG
Listeria seeligeri serovar 1/2b str. SLCC3954
lse_0478 hisJ -107 6.1 CATATTAGCACGTTAAAGCG
lse_0477 hisZ -54 6.1 CGCTTTAACGTGCTAATATG
Listeria welshimeri serovar 6b str. SLCC5334
lwe0535 hisZ -55 5.8 TGCTTTAACGTGCTAATATG
lwe0536 hisJ -104 5.8 CATATTAGCACGTTAAAGCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD