Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PUR in Shewanellaceae

Properties
Regulator family: [Other]
Regulation mode:
Biological process: Purine metabolism
Effector:
Regulog: PUR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_0779 gcvT -228 5.6 TATAATTTCGCCGCATTTTA
SO_3554 purE -113 4.8 TATTATTCTGCGCCATGATG
SO_2760 purM -31 5.6 TAGAATACGGCCGCATAAAA
SO_3293 guaB -59 4.5 TATAATCCCGCCGCAATATT
Shewanella putrefaciens CN-32
Sputcn32_3211 gcvT -84 5.6 TATAATTTCGCCGCATTTTA
Sputcn32_1596 purM -52 5.6 TAGAATACCGCCGCATAAAA
Sputcn32_1041 purE -113 4.3 TATTATTCTGCGCCATGGTG
Sputcn32_2646 guaB -58 4.5 TATAATCCCGCCGCAATATT
Shewanella sp W3-18-1
Sputw3181_0730 gcvT -84 5.6 TATAATTTCGCCGCATTTTA
Sputw3181_1361 guaB -58 4.5 TATAATCCCGCCGCAATATT
Sputw3181_2426 purM -52 5.6 TAGAATACCGCCGCATAAAA
Sputw3181_3124 purE -113 4.8 TATTATTCTGCGCCATGATG
Shewanella sp ANA-3
Shewana3_3501 gcvT -228 5.6 TATAATTTCGCCGCATTTTA
Shewana3_3155 purE -113 4.8 TATTATTCTGCGCCATGATG
Shewana3_2545 purM -52 5.6 TAGAATACCGCCGCATAAAA
Shewana3_1235 guaB -59 4.5 TATAATCCCGCCGCAATATT
Shewanella sp MR-4
Shewmr4_3331 gcvT -230 5.6 TATAATTTCGCCGCATTTTA
Shewmr4_2975 purE -113 4.8 TATTATTCTGCGCCATGATG
Shewmr4_1234 guaB -59 4.5 TATAATCCCGCCGCAATATT
Shewmr4_2380 purM -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella sp MR-7
Shewmr7_0622 gcvT -229 5.6 TATAATTTCGCCGCATTTTA
Shewmr7_3057 purE -113 4.8 TATTATTCTGCGCCATGATG
Shewmr7_1305 guaB -59 4.5 TATAATCCCGCCGCAATATT
Shewmr7_2452 purM -52 5.6 TAGAATACCGCCGCATAAAA
Shewanella baltica OS155
Sbal_0617 gcvT -280 5.6 TATAATTTCGCCGCATTTTA
Sbal_2984 guaB -58 4.5 TATAATCCCGCCGCAATATT
Sbal_1735 purM -52 5.6 TAGAATACCGCCGCATAAAA
Sbal_1036 purE -113 4.7 TATTATTCAGCGCCATGATG
Shewanella denitrificans OS217
Sden_1269 guaB -57 4.3 TATAATCTCGCCGCAATATT
Sden_2094 purM -51 5.8 TAGAATGCCGCCGCATAAAA
Shewanella frigidimarina NCIMB 400
Sfri_1137 guaB -55 4.3 TATAATCTCGCCGCAATATT
Sfri_1452 purM -53 5.2 TAGAATATTGCCGCATAAAA
Sfri_3151 gcvT -62 4.2 ATAATTTTGGCCGCATTTTA
Shewanella amazonensis SB2B
Sama_2721 gcvT -73 5.6 TATAATTTCGCCGCATTTTA
Sama_2097 purM -53 5 TAGAATACGGCCCCAATAAA
Sama_2359 guaB -57 5.1 TATAATGCCGCCGCAATATT
Shewanella loihica PV-4
Shew_1513 purM -52 5.4 TAGAATAGCGCCGCATAAAA
Shew_3064 gcvT -302 5.3 TATAATTTCGCCGCATTTTG
Shew_1297 guaB -56 4.5 TATAATCCCGCCGCAATATT
Shew_2816 tsx -75 4.6 TAAAATGCGGCGCCAACAAA
Shewanella pealeana ATCC 700345
Spea_3303 gcvT -164 5.6 TATAATTTCGCCGCATTTTA
Spea_1313 guaB -56 4.3 TATAATCTCGCCGCAATATT
Spea_3049 tsx -80 5 TAGAATGCGACGCCATAAAA
Spea_2577 purM -58 5 TAGAATGGCGCCGCGTAAAA
Shewanella halifaxensis HAW-EB4
Shal_3375 gcvT -144 5.6 TATAATTTCGCCGCATTTTA
Shal_1376 guaB -56 4.3 TATAATCTCGCCGCAATATT
Shal_3137 tsx -81 5.3 TAAAATGCGGCACCATAAAA
Shal_1680 purM -59 5.4 TAGAATGACGCCGCATAAAA
Shewanella piezotolerans WP3
swp_0913 gcvT -94 5.6 TATAATTTCGCCGCATTTTA
swp_1463 guaB -56 4.3 TATAATCTCGCCGCAATATT
swp_1228 tsx -78 5.5 TAAAATGCGGCGCCATAAAA
swp_1818 purM -57 5.4 TAGAATAGCGCCGCATAAAA
Shewanella sediminis HAW-EB3
Ssed_3675 gcvT -144 5.3 TATAATTTCGCCGCATTTTG
Ssed_3124 guaB -58 4.5 TATAATCCCGCCGCAATATT
Ssed_3379 tsx -77 4.7 TAAAATGCGGCACGATAAAA
Ssed_1845 purM -62 5.4 TAGAATAGCGCCGCATAAAA
Shewanella woodyi ATCC 51908
Swoo_3969 gcvT -160 5.6 TATAATTTCGCCGCATTTTA
Swoo_1559 guaB -57 4.5 TATAATCCCGCCGCAATATT
Swoo_3550 tsx -79 5.5 TAAAATGCGGCGCCATAAAA
Swoo_2744 purM -53 5.6 TAGAATGGCGCCGCATAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD