Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HisR in Thermoanaerobacterales

Properties
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Regulog: HisR - Thermoanaerobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Anaerocellum thermophilum DSM 6725
Athe_1480 hisZ -36 5.8 CACTTCATTATGATAAAGTA
Caldicellulosiruptor saccharolyticus DSM 8903
Csac_2027 hisZ -37 5.6 CACTTCATCATGATAAAGCA
Carboxydothermus hydrogenoformans Z-2901
CHY_1084 hisG -31 5.7 CACTTTAACAAAATAAAGTG
CHY_1082 hisR -50 5.5 TATTTTAGTATATTAAAGTA
Moorella thermoacetica ATCC 39073
Moth_2037 hisZ -32 5.4 TACGTTAACATAGTAAAGTA
Thermoanaerobacter ethanolicus X514
Teth514_0999 hisZ -45 5.3 TACTTTATCACGTTACAAAG
Thermoanaerobacter italicus Ab9
Thit_1821 hisZ -45 5.3 TACTTTATCACGTTACAAAG
Thermoanaerobacter tengcongensis MB4
TTE2140 hisZ -43 5.3 TACTTTATCACGTTACAAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD