Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator TyrR in Vibrionales

Properties
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: TyrR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Photobacterium profundum SS9
PBPRA2465 tyrP -224 6 ATGTAAATATAAGTTTACAT
PBPRB1165 hmgA -321 5.7 GTGTAACATAAATTTTACAT
PBPRB1165 hmgA -164 4.3 ATGTAAAATATTCAACACAC
PBPRA2465 tyrP -37 4.5 GTGTAAAGTTTTATGAACAT
PBPRA0794 COG1284 -106 5.7 ATGTAAAAAAATCATTACAG
PBPRB1164 phhA -243 5.7 ATGTAAAATTTATGTTACAC
PBPRA2512 COG0733 -74 5.4 CTGTACATAATAGTTTACAG
PBPRA3026 aroF -171 5.2 GTGTAAACTTAAGTTTACGA
Vibrio angustum S14
VAS14_00826 tyrR -147 4.6 GTGTAAACTCATATTAATAC
VAS14_18444 tyrP -312 5.6 ACGTAAATATAAATTTACAT
VAS14_20611 aroF -161 6.1 CTGTAAATAATTATTTACAG
VAS14_11214 hmgA -109 4.2 TTGTAAACAAGAATGAACAT
VAS14_18444 tyrP -125 5.9 ATGTAACTAAAAGTTTACAC
VAS14_16576 COG1284 -106 6 GTGTAAAAAATATATTACAG
VAS14_11219 phhA -182 3.8 ATGTTCATTCTTGTTTACAA
VAS14_13304 COG0733 -243 4.8 GTGTAAACCTTAAATAACAC
Vibrio cholerae O1 biovar eltor str. N16961
VC1344 hpd -256 4.8 AAGTAACAATATTGTTACAT
VC1344 hpd -86 4.7 ATGTAATAAAATTGTTACCT
VCA0829 acsA -144 5.4 ATGTAACAATAATTTTACAA
VC0695 aroF -28 6.3 GTGTAAATAATAAATTACAG
VC0695 aroF -135 5.4 GTGTAATTTTTAATTTACAT
VCA0772 tyrP -20 5 ATGTATAAAAGAGTTTACAC
VCA0772 tyrP -168 6.1 GTGTAAATTATTAATTACAG
VCA0828 phhA -34 5.4 TTGTAAAATTATTGTTACAT
VC1669 COG0733 -50 5.7 GTGTAATTTTATTTTTACAC
Vibrio fischeri ES114
VF_A0751 tyrR -41 5.6 GTGTAAACATATTTTGACAC
VF_1197 tyrP -132 6.1 GTGTAAACATATAATTACAG
VF_1605 COG0733 -78 5.2 ATGTACAAAAATATGTACAC
VF_0553 aroF -29 5.8 ATGGAAATAAAAGTTTACAG
VF_0553 aroF -139 5.1 CTGTAAACTTAAATTTACGA
Vibrio harveyi ATCC BAA-1116
VIBHAR_05420 acsA -130 4.9 GTGTAACATTTTCTTTACAT
VIBHAR_02177 hpd -147 5.2 CTGTAACATAAATTTTACAA
VIBHAR_02530 tyrP -287 5.5 GTGTATAAAATAGTTTACAC
VIBHAR_02530 tyrP -139 5.2 CTGTAAAGATAAATATACAA
VIBHAR_05421 phhA -111 6.1 ATGTAAAGAAAATGTTACAC
VIBHAR_00992 aroF -29 6 GTGTAAACATAAATATACAG
VIBHAR_00992 aroF -139 6.4 ATGTAAATTAAAATTTACAC
VIBHAR_02692 COG0733 -136 5.9 GTGTACATTAATATTTACAC
Vibrio parahaemolyticus RIMD 2210633
VPA0575 acsA -130 5.1 ATGTAACATATTGTTTACAT
VP1349 hpd -154 5.6 GTGTAACATTAATTTTACAT
VP0546 aroF -29 6 GTGTAAAAATAAATATACAG
VP1426 tyrP -167 6.1 GTGTAAATATAATTTTACGG
VP1426 tyrP -19 5.4 ATGTAAAGATAAATATACAA
VPA1185 aroG -222 5.4 GTGTAAATATTATTTTACGA
VP1184 COG0733 -80 6 GTGTATATAAATATTTACAC
VPA0576 phhA -111 5.6 ATGTAAACAATATGTTACAT
VP0546 aroF -139 6.5 GTGTAAATTAATATTTACAG
Vibrio salmonicida LFI1238
VSAL_II0864 tyrR -41 5.2 CTGTAAACATATTGTGACAC
VSAL_I1774 tyrP -117 5.3 TTGTAATAATAAGTTTACAC
VSAL_I0653 aroF -137 5.1 TTGTAAATTTAAGTTTACGA
VSAL_I1935 COG0733 -52 5.6 ATGTAAAATATAATTTACAA
VSAL_I0653 aroF -28 5.2 ATGGACATAAAAGTTTACAG
Vibrio shilonii AK1
VSAK1_19029 hpd -169 4.8 ATGTAGCAAAAATGTTACAA
VSAK1_21594 acsA -136 5.5 GTGTAACAATTTATTTACAT
VSAK1_15307 tyrP -144 4.6 AGATAAATTTATGTTTACAT
VSAK1_15307 tyrP -165 5.1 CTGTAAACACACTTTTACAC
VSAK1_10508 COG1284 -111 5.1 GTGTAAAATTTGAATTACAT
VSAK1_14082 aroF -28 6.4 GTGTAAAATAATATTTACAG
VSAK1_21599 phhA -109 6.3 ATGTAAATAAATTGTTACAC
VSAK1_01272 COG0733 -154 5.9 GTGTAAACTAAAGATTACAC
VSAK1_16422 COG0733 -136 5.2 GTGTATAAAAATAAATACAC
VSAK1_14082 aroF -141 6 GTGTAAAATTATATTTACAT
Vibrio splendidus LGP32
VS_0547 aroF -135 6.2 GTGTAAACTTAAATTTACAC
VS_II1521 hpd -146 5.4 GTGTAACAAATATTTTACAA
VS_0547 aroF -28 6 GTGTAAAAATAAATATACAG
VS_II1509 phhA -107 6.5 GTGTAAATAAAATGTTACAC
VS_1793 tyrR -93 4.9 GAGTAAACATATGTTTACTC
VS_II1510 acsA -112 5.6 GTGTAACATTTTATTTACAC
VS_II0802 tyrP -163 5.1 CTGTACATATTAATATACAG
VS_II0802 tyrP -144 4.5 GTGGATATTTTTAATTACAT
VS_II0387 aroG -190 5.1 GTGTAAATAATGTTATACGG
VS_1980 COG0733 -87 5.9 GTGTAAATTATTATATACAC
Vibrio vulnificus CMCP6
VV2_0456 acsA -135 4.7 GTGTAACATTTTCTTTACAA
VV1_2768 hpd -252 4.6 GGTTAACATAAAATTTACAT
VV1_2768 hpd -137 4.7 GTGTAACAAATGCTTTACAT
VV1_0495 aroF -30 5.9 GTGTAAAAAATAATATACAG
VV1_0495 aroF -137 5.6 GTGTAATTTATTTTTTACAC
VV1_2293 tyrP -169 4.9 GTGTATTATTAAGTTTACAC
VV1_2293 tyrP -21 4.8 CCGTAAATATAAGAATACAC
VV1_0287 COG1284 -112 4.7 CTGTAAAACAACAATTACAT
VV20558 aroG -184 5.4 GTGTAATTATTTTTTTACAT
VV20455 phhA -111 5.9 TTGTAAAGAAAATGTTACAC
VV1_2869 COG0733 -82 5.3 GTGTAAAAAATTTTGTACAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD