Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GcvR in Pseudomonadales

Properties
Regulator family: TyrR
Regulation mode: activator
Biological process: Glycine metabolism
Effector: Glycine
Regulog: GcvR - Pseudomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azotobacter vinelandii AvOP
Avin_26020 gcvP -180 5.7 CCGTAACGATTTCGTTCCGA
Avin_26020 gcvP -250 5.3 TCGTAACGATTTCGAAACAA
Pseudomonas aeruginosa PAO1
PA2446 gcvH -264 4.4 CTGTAACGCTTCGGTTACGA
PA2446 gcvH -163 5.4 CTGTAACGAAAGCGTTCCAT
PA2446 gcvH -244 5.6 GTGGAACGAATTCGTTCCGA
Pseudomonas entomophila L48
PSEEN4435 gcvH -265 5.4 CCGTATCGAATTCAATCCAC
PSEEN4435 gcvH -246 4.6 CCGTAATCAAATCATTCCAC
PSEEN4435 gcvH -165 5.7 GTGTATCGATTTCGTTCCAT
Pseudomonas fluorescens Pf-5
PFL_4640 gcvH -280 5 CTGTACTGAAAGCGCTACAG
PFL_4640 gcvH -261 5.7 GTGGAACGATTTCGCTACAA
PFL_4640 gcvH -180 5.5 CTGTAGCGTTTTCGCTACGG
Pseudomonas mendocina ymp
Pmen_1346 gcvH -258 5.8 CTGTATCGATATCGATCCAC
Pmen_1346 gcvH -239 4.7 CCGTAACGATTTAGCAACAA
Pmen_1346 gcvH -158 5.7 TCGTATCGATATCGTTCCAG
Pseudomonas putida KT2440
PP0989 gcvH -166 5.7 CTGTAACGATATCATTCCAC
PP0989 gcvH -266 5.2 ATGTATCGTTTTCGCTACGT
PP0989 gcvH -247 5.4 TCGTAGCGAAAACGATACAC
Pseudomonas syringae pv. tomato str. DC3000
PSPTO1277 gcvH -156 5.8 CCGTAGCGATTTCGCTACAG
PSPTO1277 gcvH -256 5.4 GCGAAACGAAATCGTTCCAC
PSPTO1277 gcvH -237 5.4 CCGTAACGATTACATTACAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD