Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Nocardiaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Nocardiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Nocardia farcinica IFM 10152
nfa12260 gdh -131 5.9 AGTCCTGTATATACAAGCAA
nfa12270 hutU -81 5.9 TTGCTTGTATATACAGGACT
nfa12290 COG1113 -107 6.2 ATTCCTGTATAGACAGGCTT
nfa12330 COG1457 -99 5.9 CAGCCTGTCTATACAGGCAT
nfa12300 fadE15 -175 6.2 AAGCCTGTCTATACAGGAAT
Rhodococcus erythropolis PR4
RER_51330 COG1457 -151 6.1 ACGCCTGTATATACAGGCAT
RER_51250 gdh 67 5.2 AAACCTGTATAGACAAGTTG
RER_51260 fadE15 -174 5.2 CAACTTGTCTATACAGGTTT
Rhodococcus opacus B4
ROP_47410 gdh -90 4.7 AGTCCTGTATAGACAACCCC
ROP_47400 COG1457 -134 4.7 GGGGTTGTCTATACAGGACT
Rhodococcus sp. RHA1
RHA1_ro04643 COG1457 -136 4.7 GGGGTTGTCTATACAGGACT
RHA1_ro04644 gdh -90 4.7 AGTCCTGTATAGACAACCCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD