Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CJA_0601 in Oceanospirillales/Alteromonadales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Hypothetical ABC transporter
Effector:
Regulog: CJA_0601 - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Cellvibrio japonicus Ueda107
CJA_0598 HCH_01828 -61 6.1 TGTGTATTAGTGTATTGATACACG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD