Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Shewanellaceae

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_1980 prs -170 6.9 ATAGTGTCTAAAAGACACTAT
SO_1980 prs -84 6.6 ATAATGTCTTTAAGACACTAT
Shewanella putrefaciens CN-32
Sputcn32_2327 prs -170 6.7 ATAGTGTCTAAAGGACACTAT
Sputcn32_2327 prs -84 6.6 ATAATGTCTTTAAGACACTAT
Shewanella sp W3-18-1
Sputw3181_1681 prs -170 6.7 ATAGTGTCTAAAGGACACTAT
Sputw3181_1681 prs -84 6.6 ATAATGTCTTTAAGACACTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD