Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ArgR in Streptomycetaceae

Properties
Regulator family: ArgR
Regulation mode: repressor (activator)
Biological process: Arginine biosynthesis
Effector: Arginine
Regulog: ArgR - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_6778 argG -36 3.8 TCATGCAGAGCCCTGCATAC
SAV_6778 argG -26 5.2 CCCTGCATACTCATGCATGT
SAV_801 argG -37 4.6 CCTTGCATGAAAATGCGCGA
SAV_3165 SCO2628 -28 3.9 CAGTGCAAGATCCTGCAGGA
SAV_1487 SCO1086 -44 4.6 CGATGCATAGATATGCGATC
SAV_6763 argC -55 4.2 GATTGCATAAACGTGCAGCG
SAV_6763 argC -35 4.6 AAACGTATAGTCATGCCATC
Streptomyces coelicolor A3(2)
SCO1570 argH -59 3.9 ACATGCAGAGTTCTGCATAC
SCO1570 argH -49 5.3 TTCTGCATACTCATGCATGA
SCO7036 argG -37 5.3 CTTTGCATGGTCATGCGTAA
SCO7036 argG -27 4.3 TCATGCGTAATGATGCATAC
SCO2015 cpdB -178 3.6 CCACGCATGACCACTCAACA
SCO2686 SCO2628 -42 5.1 TGTGGCATGATCATGCATTG
SCO1086 SCO1086 -44 4.9 CACTGCATAGGTATGCGTTC
SCO1580 argC -57 4.5 CATTGCATAAACGTGCATCG
SCO1580 argC -37 4.1 GCACGTATAGTCATGCTCTC
Streptomyces griseus subsp. griseus NBRC 13350
SGR_3668 argG -27 5.1 TCATGCATAAGAATGCATAC
SGR_5966 argG -47 4.4 GACTGCATAGTTATACCCAT
SGR_6519 SCO1086 -70 4.5 TCGCGCATAACCATGCGACC
SGR_5960 argC -57 3.8 CTTTGCATAAAAGTGCGCCG
SGR_5960 argC -37 4.5 CTGCGTATAGTCATGCCATC
SGR_3668 argG -37 5.3 TGTTGCATGATCATGCATAA
Streptomyces scabiei 87.22
SCAB_74201 argC -35 4.6 AAACGTATAGTCATGCCATC
SCAB_74201 argC -55 4.2 GATTGCATAAACGTGCAGCG
SCAB_82621 SCO1086 -71 4.2 GACTGCATAGATATACGGTC
SCAB_74301 argH -71 4 TCATGCAGAGTTCTGCATAC
SCAB_74301 argH -61 5.3 TTCTGCATACTCATGCATGA
SCAB_44121 argG -37 5.5 CTTTGCATGATCATGCGTTG
SCAB_44121 argG -27 3.7 TCATGCGTTGGCGTGCATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD