Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Listeriaceae

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Listeriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Listeria innocua Clip11262
lin0195 srmB -57 4.7 TGATGCGAACGTAGGTTCTGTGTT
lin2426 int -33 4.6 AAAAAAGAACGTATGTGCGAAAGG
lin1681 lin1681 -47 4.6 AAAAGGGAACGTATGTTTTATGAT
lin2632 uvrB -163 6.1 GAATACGAAAATATGTTCGGTTTT
lin1435 recA -142 6.3 AAATACGAATAAATGTTCGCTTTT
lin1340 lexA -144 6 AAAAAAGAATGTACGTTCGCTTTT
lin1340 lexA -84 5.6 AAAAACGAACCTTTGTTTGCATAT
lin1871 pcrA -44 5.8 AAATAAGAACAAATGTTTGTATGG
lin2325 yhaO -42 5.9 TAATAAGAACGTATATTCGGTTTT
lin2369 addB -30 5.8 AAATAAAAACATATGTTCGGTGGT
lin1609 dnaE -75 5.6 AAACGCGAACACACTTTCTTTTTT
lin2822 lmo2675 -73 5.5 AAACAAGAACGTTTGTTCGTATAA
lin2082 dinP -38 5.5 GAATAAGAACGCTTGTTCGTTTTA
Listeria monocytogenes EGD-e
lmo1640 lin1681 -47 4.9 AAAACAGAACATATGTTTTATCAT
lmo0157 srmB -57 4.3 TGTTGCGAACGTAGGTTCTGTGTT
lmo2332 int -33 4.6 AAAAAAGAACGTATGTGCGAAAGG
lmo2489 uvrB -165 6.3 AAATGCGAAAATATGTTCGGTTTT
lmo1398 recA -142 6.3 AAATACGAATAAATGTTCGCTTTT
lmo1302 lexA -144 5.9 CAAAAAGAATGTATGTTCGCTTTT
lmo1302 lexA -84 5.6 AAAAACGAACCTTTGTTTGCATAT
lmo2222 yhaO -41 5.9 TAATAAGAACGTATATTCGGTTTT
lmo1574 dnaE -75 5.8 AAACACGAACACACTTTCTTTTTT
lmo1759 pcrA -44 5.8 AAATAAGAACAAATGTTTGTATGG
lmo2268 addB -30 5.8 AAATAAAAACATATGTTCGGTGGT
lmo1975 dinP -38 5.6 GAATAAGAACGCTTGTTCGTTTTG
lmo2675 lmo2675 -72 5.6 TAATAAGAACATTTGTTCGTATAA
Listeria seeligeri serovar 1/2b str. SLCC3954
lse_1561 lin1681 -47 4.7 AAAATAGAACGTATGTTTTATGAT
lse_2389 uvrB -165 6.4 AAATACGAAAATATGTTCGGTTTT
lse_1315 recA -143 6.3 AAATACGAATAAATGTTCGCTTTT
lse_1219 lexA -83 5.6 AAAAACGAACCTTTGTTTGCATAT
lse_1219 lexA -142 5.7 CCAAAAGAATGTATGTTCGCTTTT
lse_1731 pcrA -44 5.8 AAATAAGAACAAATGTTTGTATGG
lse_2202 yhaO -44 5.9 TAATAAGAACGTATATTCGGTTTT
lse_1489 dnaE -75 5.8 AAACACGAACACACTTTCTTTTTT
lse_2581 lmo2675 -72 5.2 CAACAAGAACATTCGTTCGTATAA
lse_2247 addB -30 5.6 AAATAAAAACGTATGTTCGGTGGT
lse_1955 dinP -39 5.5 ATTAAGGAACATTTGTTCGTTTTT
Listeria welshimeri serovar 6b str. SLCC5334
lwe1656 lin1681 -47 5.1 AAAACAGAACATATGTTTTATGAT
lwe2437 uvrB -166 6.4 AAATACGAAAATATGTTCGGTTTT
lwe1414 recA -143 6.3 AAATACGAATAAATGTTCGCTTTT
lwe1317 lexA -84 5.6 AAAAACGAACCTTTGTTTGCATAT
lwe1317 lexA -146 5.9 CAAAAAGAATGTATGTTCGCTTTT
lwe1776 pcrA -38 5.8 AAATAAGAACAAATGTTTGTATGG
lwe2239 yhaO -39 5.9 TAATAAGAACGTATATTCGGTTTT
lwe2283 addB -30 5.8 AAATAAAAACATATGTTCGGTGGT
lwe1587 dnaE -75 5.8 AAACACGAACACACTTTCTTTTTT
lwe2624 lmo2675 -72 5.1 AAAATAGAACGCTTGTTCGTATAA
lwe1994 dinP -41 5.3 GATTAAGAACGTTTGTTCGATTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD