Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Alcaligenaceae

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Alcaligenaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bordetella avium 197N
BAV2027 imuA -39 6.4 TACTGTATATTCATACAGTA
BAV2545 uvrD -27 5.7 GTCTGTATATATATACAGTG
BAV2808 uvrA -134 5.8 TACTGTTTATCTATACAGCA
BAV2309 recA -172 5.8 TACTGTTTGTTTGTACAGTA
BAV1370 PF4055 -28 5.7 TACTGTGTTTTTGTACAGTA
BAV1503 lexA -62 5.5 CGCTGTATATACATACAGTC
BAV2034 dinB -44 5.9 TACCGTATATTTATCCAGTA
Bordetella bronchiseptica RB50
BB3086 imuA -35 6.3 TACTGTATATTTATACAGTG
BB1810 uvrD -41 6.3 TTCTGTATAAATATACAGTA
BB4032 uvrA -150 6.1 TACTGTTTATTTATACAGCA
BB2076 recA -135 5.7 CACTGGATTTTTATCCAGTA
BB3446 PF4055 -25 5.3 TACTGCGTTTTTGTACAGTA
BB2271 lexA 38 5.2 CGCTGTATATCCATACAGTC
Bordetella petrii DSM 12804
Bpet2611 imuA 60 6.3 TACTGTATATTTGTACAGTA
Bpet3400 uvrD -6 5.6 GTCTGGATGAATATACAGTA
Bpet0873 uvrA -180 5.7 TACTGTTTATATATACAGAT
Bpet2056 recA -136 6 TACTGGATTTTTATCCAGTA
Bpet1911 PF4055 -25 5.6 TACTGGTTTTTTGTACAGTA
Bpet2782 lexA -39 5.5 TGCTGTATATCCATACAGTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD