Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Chlamydiales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Chlamydiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chlamydia muridarum Nigg
TC0673 hcrA -72 5.8 CTAGCACTCTTTGCTCGCGAGCGCTAA
TC0387 groS -161 6.1 ATAGCAGTTGAGGTGCTCAACTGCTAA
Chlamydia trachomatis D/UW-3/CX
CT394 hcrA -72 6 CTAGCACTCTTTAGTTGCGAGCGCTAA
CT111 groS -161 6.1 ATAGCAGTTGATCATGCCAACTGCTAA
Chlamydophila abortus S26/3
CAB239 hcrA -101 6 TTAGCATTCTTTGAGGTTGAGTGCCAA
CAB614 groS -113 6.6 ATGGCGCTTGATATTATTAAGTGCTAA
Chlamydophila felis Fe/C-56
CF0763 hcrA -101 6.2 TTAGCATTCTTTAGAGGTGAGTGCTAA
CF0366 groS -113 7.2 ATAGCACTTGATATTATTAAGTGCTAA
Chlamydophila pneumoniae AR39
CP0253 hcrA -33 6.6 TTAGCATTCATTCAATTCGAGTGCTAA
CP0637 groS -113 7.2 TTAGCACTTAAAATTATTGAGTGCTAA
Parachlamydia sp. UWE25
pc1497 hcrA -90 7.2 ATAGCACTCGATATAATCGAGTGCTAA
pc1179 groS -138 6 TTAGCAATTAAGTTGATTCACTGCTAA
Chlamydophila caviae GPIC
CCA00243 hcrA -101 6.8 TTAGCATTCTTTAGAATCGAGTGCTAA
CCA00642 groS -116 7.1 GTAGCACTTGATATTATTAAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD