Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Thermoanaerobacterales

Properties
Regulator family: HrcA
Regulation mode:
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Thermoanaerobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Anaerocellum thermophilum DSM 6725
Athe_2138 groS -54 7.7 TTAGCACTCATTGAAAGTGAGTGCTAA
Athe_1553 hrcA -43 7.4 TTAGCACTCATCAACAGAGAGTGCTAA
Caldicellulosiruptor saccharolyticus DSM 8903
Csac_1291 groS -54 7.6 TTAGCACTCACTCTCAATGAGTGCTAA
Csac_1750 hrcA -43 7.4 TTAGCACTCATCAAATGAGAGTGCTAA
Carboxydothermus hydrogenoformans Z-2901
CHY_0806 groS -67 7.5 TTAGCACTCTATCGAAGTGAGTGCTAA
CHY_0412 hrcA -46 7.6 TTAGCACTCAACAAAAGAGAGTGCTAA
Thermoanaerobacter ethanolicus X514
Teth514_0512 groS -53 7.8 TTAGCACTCACATAAGTTGAGTGCTAA
Teth514_2081 hrcA -47 7.5 TTAGCACTCAATCGAGTAGAGTGCTAA
Thermoanaerobacter italicus Ab9
Thit_0563 groS -53 7.8 TTAGCACTCACATAAGTTGAGTGCTAA
Thit_0892 hrcA -47 7.7 TTAGCACTCAACTTGATTGAGTGCTAA
Thermoanaerobacter tengcongensis MB4
TTE0579 groS -54 7.6 TTAGCACTCATAGAAGTTGAGTGCTAA
TTE0953 hrcA -47 7.5 TTAGCACTCAATGAGTGAGAGTGCTAA
Moorella thermoacetica ATCC 39073
Moth_0545 groS -61 6.7 TTAGCACTTGAGTCCGGTGAGTGCTAA
Moth_2130 groS -50 6.8 CTAGCACTCTCTAAAATAAAGTGCTAA
Moth_0583 hrcA -46 6.7 TTAGCACTCGGAACATAAGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD