Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Listeriaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Listeriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Listeria innocua Clip11262
lin2175 groS -65 7.6 TTAGCACTCTAATGTGTCGAGTGCTAA
lin1512 hrcA -41 7.5 TTAGCACTTGACGTTATTGAGTGCTAA
Listeria monocytogenes EGD-e
lmo2069 groS -65 7.3 TTAGCACTCTGATGTGTCGAGTGCTAA
lmo1475 hrcA -41 7.3 TTAGCACTTGACGTTATGGAGTGCTAA
Listeria seeligeri serovar 1/2b str. SLCC3954
lse_2058 groS -64 7.6 TTAGCACTCTAATGTGTCGAGTGCTAA
lse_1392 hrcA -41 7.5 TTAGCACTTGACGTTATTGAGTGCTAA
Listeria welshimeri serovar 6b str. SLCC5334
lwe2090 groS -65 7.3 TTAGCACTCTGATGCGTCGAGTGCTAA
lwe1490 hrcA -41 7.4 TTAGCACTTGATGTTATTGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD