Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Deinococcus-Thermus

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Deinococcus-Thermus
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermus aquaticus Y51MC23
TaqDRAFT_5069 COG2331 -50 7.2 TTGACACTCAATGGCTTTGAGTGTCAG
TaqDRAFT_4600 groS -41 7 TTGACACTCTCGCCCTTGGAGCGTCAA
Thermus thermophilus HB27
TTC1246 COG2331 -50 6.4 TTGACACTCAAGAAGGCTAAGCGTCAA
TTC1713 groS -41 7 TTGACACTCTCACCCTTTGGGCGTCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD