Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ManR2 in Shewanellaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannose utilization; Mannosides utilization
Effector: Mannose
Regulog: ManR2 - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella amazonensis SB2B
Sama_0294 manR2 -220 6.7 CACTGTAATCGATTACATTT
Sama_0293 mnnA3 -184 6.3 AGATGTAATCGATTCCATAA
Sama_0293 mnnA3 -90 6.7 AAATGTAATCGATTACAGTG
Sama_0294 manR2 -126 6.3 TTATGGAATCGATTACATCT
Sama_0295 omp(Man) -149 6.8 CAATGTAATCGATTACATTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD