Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Chlorobiales

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Chlorobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chlorobaculum parvum NCIB 8327
Cpar_1367 groS -115 7.7 TTAGCACTCTCGTTAGGTGAGTGCTAA
Chlorobium chlorochromatii CaD3
Cag_1305 groS -101 7.3 TTAGCACTCTCACCTCGAGAGTGCTAA
Chlorobium limicola DSM 245
Clim_0497 groS -96 7.2 TTAGCACTCTTGTCCATTGAGTGCTAA
Chlorobium phaeobacteroides BS1
Cphamn1_0782 groS -107 7.4 TTAGCACTCGGTGTTGTAGAGTGCTAA
Chlorobium phaeobacteroides DSM 266
Cpha266_1937 groS -93 7.3 TTAGCACTCTTCCGTTGAGAGTGCTAA
Chloroherpeton thalassium ATCC 35110
Ctha_1617 groS -188 7.8 TTAGCACTCTATTAAGGAGAGTGCTAA
Ctha_1617 groS -113 7.8 TTAGCACTCTATTAAGGAGAGTGCTAA
Pelodictyon luteolum DSM 273
Plut_0541 groS -95 7.4 TTAGCACTCGGCGTTGTTGAGTGCTAA
Pelodictyon phaeoclathratiforme BU-1
Ppha_0833 groS -97 7.6 TTAGCACTCGACTCTGTTGAGTGCTAA
Prosthecochloris aestuarii DSM 271
Paes_0679 groS -106 7.7 TTAGCACTCAACAAAAGAGAGTGCTAA
Prosthecochloris vibrioformis DSM 265
Cvib_0585 groS -100 7.1 TTAGCACTCATCGTTTCCGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD