Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Streptomycetaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_5569 hrcA -62 6.7 CTGGCACTCGCGCGCGCTGAGTGCCAG
SAV_4991 groS -124 7 CTGGCACTCCCCACTGGAGAGTGCCAG
SAV_4991 groS -171 6.6 TTGGCACTCCGCTTGACCGAGTGCTAA
SAV_3931 groL2 -153 6.6 TTAGCACTCTGAAGGTGAGAGTGATAA
SAV_3931 groL2 -189 6.9 CTTGCACTCGGCAGGGGCGAGTGCTAA
SAV_3678 COG2331 -38 6.7 TTAGCACTCACTGAGTGAGAGTGCCAG
Streptomyces coelicolor A3(2)
SCO2555 hrcA -110 6.2 CTGGCACTCGCGAGCCATGAGTGCCAG
SCO4761 groS -173 6.6 TTGGCACTCCGCTTGACCGAGTGCTAA
SCO4761 groS -126 7.1 CTGGCACTCCCCACTGGAGAGTGCCAA
SCO4296 groL2 -189 6.5 CTTGCACTCGACCATGCCGAGTGCTAA
SCO4296 groL2 -153 6.7 TTAGCACTCTGAAGGTGAGAGTGACAA
SCO3187 COG2331 -37 6.6 TTAGCACTCATCGAGTGAGAGTGCCAG
Streptomyces griseus subsp. griseus NBRC 13350
SGR_2770 groS -183 6.6 TTGGCACTCCGCTTGACCGAGTGCTAA
SGR_4993 hrcA -62 6.6 CTGGCACTCGAACGCACCGAGTGCCAG
SGR_2770 groS -136 7.1 CTGGCACTCCCCCCTGGAGAGTGCCAG
SGR_3225 groL2 -190 6.6 CTTGCACTCGCAGGGGTCGAGTGCTAA
SGR_3225 groL2 -154 6.8 TTAGCACTCTCCAGGTGAGAGTGACAG
SGR_4291 COG2331 -36 6.5 TTAGCACTCATTGAGTGAGAGTGCCAG
Streptomyces scabiei 87.22
SCAB_61551 hrcA -16 7.2 TTGGCACTCGCCCGGGGTGAGTGCCAA
SCAB_36301 groS -125 7.1 CTGGCACTCCCCCCTGGAGAGTGCCAA
SCAB_36301 groS -172 6.1 TTAGCAGTCCGCTTGACCGAGTGCTAA
SCAB_50441 groL2 -153 6.7 TTAGCACTCTGAAGGTGAGAGTGACAA
SCAB_50441 groL2 -189 6.8 CTTGCACTCGCAGGGGGCGAGTGCTAA
SCAB_53081 COG2331 -38 6.6 TTAGCACTCATCGAGTGAGAGTGCCAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD