Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Nocardiaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Nocardiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Nocardia farcinica IFM 10152
nfa8860 groS -223 6.6 CTGGCACTCTCGTGTATAGAGTGCTAG
nfa52750 groL2 -166 7 TTGGCACTCTCGACCTGTGAGTGCCAG
nfa52750 groL2 -201 6.3 CTTGCACTCGCCACCCCCGAGTGCTAG
nfa49550 COG2331 -52 6.7 TTGGCACTGTCGGCGGTAGAGTGCTAG
nfa8400 hsp18 -85 6.7 TTAGCACTCTACCCCGAAGAGTGCTAA
Rhodococcus erythropolis PR4
RER_19230 groS -151 7 TTGGCACTCTCACGTATAGAGTGCCAA
RER_15260 groL2 -265 6.3 CTTGCACTCGGCACGCTCGAGTGCTAA
RER_15260 groL2 -230 6.8 TTGGCACTCGCGAACCGTGAGTGCCAG
RER_43910 COG2331 -81 6.7 TTGGCACTGTCACTTGTAGAGTGCTAA
RER_12450 hsp18 -81 6.6 CTGGCACTCAAGGTTGCAGAGTGCCAG
Rhodococcus opacus B4
ROP_62490 groS -150 7 TTGGCACTCTCACGTATAGAGTGCCAA
ROP_18630 groL2 -200 6.3 CTTGCACTCACCCTGTTCGAGTGCTAA
ROP_18630 groL2 -165 6.9 TTGGCACTCGCCGCGGGTGAGTGCCAG
ROP_56950 COG2331 -63 6.8 TTGGCACTGTCGGCTGTAGAGTGCTAA
Rhodococcus sp. RHA1
RHA1_ro06189 groS -150 7 TTGGCACTCTCACGTATAGAGTGCCAA
RHA1_ro02146 groL2 -165 7 TTGGCACTCACGACGCGTGAGTGCCAG
RHA1_ro02146 groL2 -200 6.2 CTTGCACTCACCCTGTCCGAGTGCTAA
RHA1_ro05630 COG2331 -64 6.9 TTGGCACTGTCGACTGTAGAGTGCTAA
RHA1_ro06632 hsp18 -101 6.8 CTGGCACTCTCGGGTGCCGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD