Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Mycobacteriaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Mycobacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Mycobacterium abscessus ATCC 19977
MAB_1084c COG2331 -63 6.6 CTAGCACTCCAAGCGGTAGAGTGCTAG
MAB_0650 groL2 -131 6.5 TTGGCACTCACGACCGGTGAGTGCTAG
MAB_0650 groL2 -166 6.7 CTTGCACTCGCCATGGCCGAGTGCTAA
MAB_3732c groS -162 6.9 CTAGCACTCTCATGTATAGAGTGCTAG
Mycobacterium avium 104
MAV_1100 COG2331 -55 6.8 CTAGCACTTGACACGCTAGAGTGCTAA
MAV_4707 groL2 -177 6.7 CTTGCACTCGGCATGGGCGAGTGCTAA
MAV_4707 groL2 -143 6.6 TTGGCACTCGCGACCAGTGAGTGCTAG
MAV_4366 groS -160 7 CTAGCACTCGCATGTATAGAGTGCTAG
Mycobacterium flavescens PYR-GCK
Mflv_1805 hsp18 -99 6.8 CTGGCACTCTCCTATCTCGAGTGCTAA
Mflv_1895 COG2331 -53 6.8 CTAGCACTTGAGCCGCTAGAGTGCTAA
Mflv_0141 groL2 -174 6.9 CTTGCACTCGCCCTGGTCGAGTGCTAA
Mflv_0141 groL2 -139 6.6 TTGGCACTCGCGACCAGTGAGTGCTAG
Mflv_4925 groS -133 7 CTAGCACTCTCGTGTATAGAGTGCTAG
Mycobacterium leprae TN
ML0180 COG2331 -54 6.6 CTAGCACTTGGCACGGTAGAGTGCCAG
ML0317 groL2 -161 6.6 CTGGCACTCGCGATCAGCGAGTGCCAG
ML0317 groL2 -196 6.5 CTTGCACTCGCCTTAGGGGAGTGCTAA
ML0380 groS -236 7.1 CTAGCACTCGCGTGTATAGAGTGCTAG
Mycobacterium marinum M
MMAR_4523 COG2331 -55 6.7 CTAGCACTTGAAACGGTAGAGTGCTAA
MMAR_0759 groL2 -175 6.9 TTGGCACTCGCGACCCGCGAGTGCTAG
MMAR_0759 groL2 -210 6.9 CTTGCACTCGACATAGGCGAGTGCTAA
MMAR_1125 groS -233 6.9 CTAGCACTCTCATGTATAGAGTGCTAG
Mycobacterium smegmatis str. MC2 155
MSMEG_5611 hsp18 -97 6.9 CTAGCACTCTCACATCTCGAGTGCTAA
MSMEG_5479 COG2331 -55 6.7 CTAGCACTTGAGGCGGTAGAGTGCTAA
MSMEG_0880 groL2 -141 6.7 TTGGCACTCTCGATTCGTGAGTGCTAG
MSMEG_0880 groL2 -176 6.5 CTTGCACTCACCATGCCCGAGTGCTAA
MSMEG_1582 groS -159 6.9 CTAGCACTCTCATGTATAGAGTGCTAG
Mycobacterium sp. JLS
Mjls_4761 hsp18 -99 7 CTAGCACTCGCATGTGTCGAGTGCTAA
Mjls_4670 COG2331 -53 6.8 CTAGCACTTGAGCCGGTAGAGTGCTAA
Mjls_0598 groL2 -141 6.8 CTGGCACTCGCGACCGGTGAGTGCTAG
Mjls_0598 groL2 -176 6.8 CTTGCACTCTCCCTGGTCGAGTGCTAA
Mjls_1180 groS -86 7 CTAGCACTCGCATGTATAGAGTGCTAG
Mycobacterium tuberculosis H37Rv
Rv0991c COG2331 -54 6.8 CTAGCACTTGAGACGGTAGAGTGCTAA
Rv0440 groL2 -219 6.6 CTTGCACTCGGCATAGGCGAGTGCTAA
Rv0440 groL2 -184 6.7 TTGGCACTCGCGACCGGTGAGTGCTAG
Rv3418c groS -199 6.9 CTAGCACTCTCATGTATAGAGTGCTAG
Mycobacterium vanbaalenii PYR-1
Mvan_4943 hsp18 -99 6.7 CTGGCACTCTCACAGCTCGAGTGCTAA
Mvan_4835 COG2331 -54 6.8 CTAGCACTTGACCCGGTAGAGTGCTAA
Mvan_0764 groL2 -175 6.9 CTTGCACTCGCCCAGGTCGAGTGCTAA
Mvan_0764 groL2 -140 6.6 TTGGCACTCGCGACCAGTGAGTGCTAG
Mvan_1494 groS -131 7 CTAGCACTCTCGTGTATAGAGTGCTAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD