Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Micrococcineae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Arthrobacter sp. FB24
Arth_2887 groS -185 6.8 CTGGCACTCGCCTTGACCGAGTGCTAA
Arth_2887 groS -138 6.8 TTAGCACTCTCCCTAGGAGGGTGCTAA
Arth_0779 groL2 -244 6.7 CTTGCACTCTCCCCGGGGGAGTGCTAA
Arth_0779 groL2 -209 6.3 TTAGCACTCCCACGGACTGACTGCTAA
Arth_2236 hrcA -95 6.3 TTAGCACTTAGACATGTCGAGTGCTAA
Arth_2866 COG2331 -112 6.4 TTAGCACTCAGGCCCTGCGACTGCTAA
Arthrobacter aurescens TC1
AAur_2875 groS -122 6.7 TTAGCACTCTCCCCCGGAGGGTGCTAA
AAur_2875 groS -167 6.6 CTGGCACTCACCTTGACCGAGTGCTAA
AAur_1001 groL2 -245 6.6 CTTGCACTCTCCCCGGTCGAGTGCTAA
AAur_1001 groL2 -210 6 TTAGCACTCCTATGGTTCGACTGCTAA
AAur_2854 COG2331 -87 6.4 TTGGCACTCAGGCCCTGCGACTGCTAA
Arthrobacter chlorophenolicus A6
Achl_2595 groS -136 6.8 TTAGCACTCTCCCGAGGAGGGTGCTAA
Achl_2595 groS -182 6.8 CTGGCACTCGCCTTGACCGAGTGCTAA
Achl_0894 groL2 -204 6.3 TTAGCACTCTGACGTACCGACTGCTAA
Achl_0894 groL2 -239 6.5 CTTGCACTCTCACCGGGGGAGTGCTAA
Achl_2573 COG2331 -90 6.4 TTAGCACTCAGGCCCTGCGACTGCTAA
Achl_1973 hrcA -110 6.2 TTAGCACTTAGGCATGTCGAGTGCTAA
Beutenbergia cavernae DSM 12333
Bcav_3058 groS -180 6.9 TTGGCACTCGCCTTGACCGAGTGCTAA
Bcav_0821 groL2 -177 6.5 CTTGCACTCGCAGGAGGAGAGTGCCAA
Bcav_0821 groL2 -143 6.4 TTAGCACTCTCACCACGAGAGTGACAA
Bcav_1748 hrcA -47 6.4 TTGGCACTCGGCCCGGGTGAGTGCTGG
Bcav_0902 COG2331 -64 5.9 TTGGCACTCGGTAGTGACAAGTGCTAG
Brachybacterium faecium DSM 4810
Bfae_08630 groS -132 6.1 TTGGCAGTCGACGGCCGAGAGTGCCAG
Bfae_08630 groS -182 6.3 TTAGCACTCGTGTTGCGTGAGTGCCAG
Bfae_07610 groL2 -246 6.3 TTAGCACTCTCCGCCGTCGAGTGCTTA
Bfae_07610 groL2 -212 5.6 CTGGCACTCGTGGATCGAGAGTGACAG
Bfae_17300 hrcA -98 6 TTGGCACCTGGCACGGCAGAGTGCCAG
Brevibacterium linens BL2
BlinB01001687 groS -182 6.6 TTGGCACTCGAGTTGACCGAGTGCTAA
BlinB01001687 groS -137 6.1 TTAGCACTAGCACTCAGTGAGTGCCAG
BlinB01000562 groL2 -184 6.8 TTTGCACTCGCATGGGGAGAGTGCTAA
Clavibacter michiganensis subsp. michiganensis NCPPB 382
CMM_2568 groS -65 6.4 CTGGCACTCTCCTCGGGAGATTGCCAA
CMM_2568 groS -112 6.5 TTGGCACTCGCGTTGCGCGAGTGCAAG
CMM_2478 groL2 -71 6.3 CTGGCACTCCCTCACGGGGAGTGCTAG
CMM_2478 groL2 -106 6.3 CTTGCACTCCCGTAGGGCGAGTGCCAG
CMM_1564 hrcA -39 5.9 TTGGCAGTCAGAACCGACGAGTGCCAG
CMM_2092 hsp18 -97 6.6 TTGGCACTCCCCTGCGTCGAGTGCTAA
Janibacter sp. HTCC2649
JNB_17483 groS -137 6.8 TTGGCACTCGCCCTGTGTGAGTGCCAG
JNB_17483 groS -185 6.6 TTGGCACTCGAGTTGACCGAGTGCTAA
JNB_16609 groL2 -155 6.4 TTGGCACTCTCCTTAAAGGAGTGCCAA
JNB_16609 groL2 -189 6.5 TTTGCACTCTCCACCCGAGAGTGCCAA
JNB_05025 hrcA -48 6.2 TTGGCACTCACCAAGCATGAGTGCCAG
Jonesia denitrificans DSM 20603
Jden_0635 groS -146 6.9 TTGGCACTCGCCTTGACCGAGTGCTAA
Jden_2055 groL2 -180 6.5 CTTGCACTCTCCATGCGAGAGTGCCAA
Jden_2055 groL2 -146 6.4 TTGGCACTCTCGCATGGAGAGTGATAA
Jden_1550 hrcA -50 6.6 TTGGCACTCGGCAGTGGGGAGTGCCAA
Jden_1970 COG2331 -77 5.9 TTAGCACTCAGAAGATGAGAGTGCTGG
Kocuria rhizophila DC2201
KRH_06750 groS -158 6.8 TTAGCACTCTCCCAGGGAGGGTGCTAA
KRH_18370 groL2 -176 6.2 TTAGCACTCAGTCGAGTGGACTGCTAA
KRH_13010 hrcA -90 6.1 TTAGCACTGTGCGCGGATGAGTGCCAA
KRH_22230 hsp18 -117 6.3 TTGGCACTCTGCTGGACCGAGTGCTAT
Kytococcus sedentarius DSM 20547
Ksed_07560 groS -183 6.2 CTGGCACTCGAGTTGACCGAGTGCCAG
Ksed_07560 groS -136 6.1 TTGGCACTCAGCGTCGTCGGGTGCCAG
Ksed_21770 groL2 -217 6.1 TTGGCACTCGGCGGCTCCGAGTGACAG
Ksed_11690 hrcA -75 5.9 CTGGCACTTGACGTCCCCGAGTGCCAG
Leifsonia xyli subsp. xyli str. CTCB07
Lxx19880 groS -59 6 TTAGCACTCTCATCATGAGGTTGCTAA
Lxx19880 groS -106 6 TTGGCACTTACGTTGCGTGACTGCTAA
Lxx18010 groL2 -70 6.6 TTAGCACTCCGCCTTACCGAGTGCTAA
Lxx18010 groL2 -104 5.9 CTTGCACTCCACCGCGACGAGTGCCAG
Lxx14650 hrcA -49 6.5 TTGGCACTCAGGATCAGCGAGTGCTAA
Lxx22708 hsp18 -91 7 TTAGCACTCTCCATGGGTGAGTGCTAA
Lxx07755 hsp18 -91 7 TTAGCACTCTCCATGGGTGAGTGCTAA
Renibacterium salmoninarum ATCC 33209
RSal33209_1769 groS -177 6.8 TTGGCACTCACCTTGACCGAGTGCTAA
RSal33209_1769 groS -130 6.4 TTAGCACTCTCGTACTGAGGGTGCTAA
RSal33209_0482 groL2 -206 6.3 CTTGCACTCTCACCCTTCGAGTGCTAA
RSal33209_0482 groL2 -171 6.5 TTAGCACTCTCCCGTTCTGACTGCTAA
RSal33209_1927 hrcA -233 6.5 TTAGCACTTGGGCAAGCCGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD