Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Alcaligenaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Alcaligenaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bordetella avium 197N
BAV0580 groS -85 7.9 TTAGCACTCGTCGCCGGTGAGTGCTAA
BAV3285 rpoH -37 7.2 TTAGCACTCAACCATTTGGAGTGCTAA
Bordetella bronchiseptica RB50
BB4835 rpoH -36 7.4 TTAGCACTCGATTGCGTGGAGTGCTAA
BB0963 groS -91 7.9 TTAGCACTCGTCGCCGGTGAGTGCTAA
Bordetella petrii DSM 12804
Bpet3931 groS -90 7.9 TTAGCACTCGCTGCCGGTGAGTGCTAA
Bpet0159 rpoH -72 7.1 TTAGCACTCGCACATAGAGAGTGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD