Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HrcA in Frankineae/Propionibacterineae/Pseudonocardiaceae

Properties
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Frankineae/Propionibacterineae/Pseudonocardiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Frankia sp. EAN1pec
Franean1_0686 COG2331 -42 5.6 TTGGCAGTCCTTACCACCGAGTGCCAA
Franean1_2109 hrcA -152 6.9 TTGGCACTCACGGCGGCCGAGTGCCAG
Franean1_3353 groL2 -140 6.7 CTGGCACTCAGCTAGGTCGAGTGCCAA
Franean1_3854 groL2 -139 6.9 TTAGCACTCGACAGGGTTGAGTGCCAA
Franean1_0175 groL2 -188 6.6 CTTGCACTCACCCATGCCGAGTGCTAA
Franean1_0175 groL2 -154 6.8 TTGGCACTCTCCCCATGGGAGTGCCAA
Franean1_6002 groS -105 6.9 TTGGCACTCGGCACTTGAGAGTGCCAG
Frankia sp. CcI3
Francci3_4042 COG2331 -42 6.5 TTGGCAGTCTCCACGTCAGAGTGCCAA
Francci3_1264 hrcA -95 6.8 TTGGCACTCACTGCGGCCGAGTGCCAA
Francci3_4398 groL2 -168 6.7 CTGGCACTCTCGCCTAGGGAGTGCCAA
Francci3_4398 groL2 -202 6.7 CTTGCACTCACCCAGGCCGAGTGCTAA
Francci3_0632 groS -108 7 TTGGCACTCGGCACGTGAGAGTGCCAG
Nakamurella multipartita DSM 44233
Namu_0179 hsp18 -98 6.8 TTGGCACTCTCGGTCGTCGAGTGCTAA
Namu_4645 COG2331 -61 6.4 CTGGCACTGGGCACTGTCGAGTGCCAA
Namu_1571 hrcA -57 6.1 TTGGCAGCCGGAGCGGGCGAGTGCCAA
Namu_4827 groL2 -192 6.3 TTGGCACTCGGAACCAACGAGTGCCAG
Namu_4827 groL2 -226 6.8 CTTGCACTCTCCGCGGTCGAGTGCTAA
Namu_1207 groS -156 6.5 CTGGCACTCCCATGGCTAGAGTGCTAG
Acidothermus cellulolyticus 11B
Acel_0609 hsp18 -54 6.6 CTAGCACTCGACAGCACCGAGTGCTAA
Acel_0161 COG2331 -37 5.9 TTAGCAATCGAAGCTACCGAGTGCTAA
Acel_0783 hrcA -78 6.6 CTGGCACTCGACAACCCTGAGTGCCAA
Acel_0101 groL2 -179 6.5 CTTGCACTCTCGACCCTTGAGTGCTAA
Acel_0101 groL2 -144 6.2 CTAGCACTCCACATCGGAGAGTGACAA
Acel_0362 groS -179 6.4 CTGGCACTCTCCTTGACGGAGTGCTAA
Acel_0362 groS -133 6.5 CTGGCACTCTCGACCCGAGGGTGCCAA
Nocardioides sp. JS614
Noca_0787 COG2331 -76 6.7 TTGGCACTCGTCAGGGCCGAGTGCCAG
Noca_1903 hrcA -73 6.6 TTGGCACTCAGGACTTTCGAGTGCCAG
Noca_3982 groL2 -195 6.7 CTTGCACTCTCAGGGGTCGAGTGCTAA
Noca_3982 groL2 -160 6.8 CTGGCACTCTCCCCCGGAGAGTGACAA
Noca_3647 groS -168 6.5 CTGGCACTCAGTTGGCGAGAGTGCTAG
Noca_3647 groS -133 6.8 TTGGCACTCTCCACCGGAGTGTGCCAG
Propionibacterium acnes KPA171202
PPA0915 hrcA -67 6.7 GTGGCACTCGGCACCCGAGAGTGCCAA
PPA0453 groL2 -195 6.5 TTGGCACTCGACAAGCGAGAGTGCTAC
PPA0453 groL2 -230 6.5 TTTGCACTCGCTGGGTGTGAGTGCTAA
PPA1773 groS -132 6.5 TTGGCACTCTCGTGGTGAGTGTGCCAA
PPA1773 groS -179 6.4 CTGGCACTCCCGTTGCCTGAGTGCCAA
Actinosynnema mirum DSM 43827
Amir_0626 COG2331 -50 6.4 TTGGCACTCGTGACGTGGGAGTGCCAA
Amir_0442 groL2 -178 6.9 CTGGCACTCGGCACTGCTGAGTGCCAG
Amir_0442 groL2 -213 6.8 CTTGCACTCTCGGGTGGCGAGTGCTAA
Amir_6544 groS -128 6.7 TTGGCACTCGAATGGGTAGAGTGCTAG
Saccharomonospora viridis DSM 43017
Svir_32690 COG2331 -72 6.6 TTAGCACTCTCGGCAATCGAGTGCCAG
Svir_34390 groL2 -168 6.9 TTGGCACTCGGCACCGTCGAGTGCTAG
Svir_34390 groL2 -203 6.6 CTTGCACTCTCACCCTGAGAGTGCTAA
Svir_04660 groS -133 6.6 CTAGCACTCAGCTGGCTAGAGTGCTAA
Saccharopolyspora erythraea NRRL 2338
SACE_0527 groL2 -180 6.8 CTGGCACTCAGCAAGGTCGAGTGCCAG
SACE_0527 groL2 -215 6.8 CTTGCACTCGCCACGCGAGAGTGCTAA
SACE_6715 groS -131 6.8 CTGGCACTCGCGTGGGTAGAGTGCTAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD