Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ModE2 in Comamonadaceae

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Regulog: ModE2 - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Comamonas testosteroni KF-1
CtesDRAFT_0891 COG1720 -50 5.9 CACGTTATATTTGACGGAATATAACACT
CtesDRAFT_0892 modA -68 5.9 AGTGTTATATTCCGTCAAATATAACGTG
Delftia acidovorans SPH-1
Daci_4259 modE2 -60 4.2 TTCGCTGTAGCGATCCATGCATTGCGTA
Daci_3883 modA -75 5.7 TTCATCGTATACGATTGAATATTTCGTA
Polaromonas sp. JS666
Bpro_2496 modE2 -103 6.9 TTCGCTATATTTAATGGAATATAGCGAA
Bpro_2497 modA -99 6.9 TTCGCTATATTCCATTAAATATAGCGAA
Variovorax paradoxus S110
Vapar_4070 modB -14 5.5 TGCGTTGTATCTTCATGAATACGACGAA
Verminephrobacter eiseniae EF01-2
Veis_3515 modE2 -212 6 TACGTCGTATTCCATCGGATATGTCAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD