Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ModE3 in Comamonadaceae

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Tungsten homeostasis
Effector: Tungsten
Regulog: ModE3 - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax sp. JS42
Ajs_3129 tupA -58 5.9 CTATGCACAAGTTTTCATAT
Ajs_3943 Ajs_3943 -65 6.4 CTATGCAAATCTTTTCATAG
Leptothrix cholodnii SP-6
Lcho_3729 fdoX -39 5.5 ATATGCAGGCCTTTGCATGG
Lcho_1816 Ajs_3943 -91 6.2 CTATGCAGATGATTGCATAG
Methylibium petroleiphilum PM1
Mpe_A2223 tupA -102 5.3 CTATGCATGCTCGTTCATAT
Polaromonas naphthalenivorans CJ2
Pnap_1509 tupA -84 5.8 CTATGCAAACAGCTTCATAA
Pnap_0048 Ajs_3943 -60 5.9 CTATGCAAATCAATTCATAG
Polaromonas sp. JS666
Bpro_0936 fdoX -48 5.8 GTATGCAAACCGTTGCATAC
Bpro_1758 tupA -85 5.8 CTATGCAAACCCATTCATAA
Rhodoferax ferrireducens DSM 15236
Rfer_3262 fdoX -41 6.1 CTATGCAAATAGTTGCATAA
Rfer_2869 tupA -58 5.2 CTATGCACGGTGGTTCATAT
Variovorax paradoxus S110
Vapar_1588 tupA -74 6.1 CTATGCAAAATCCTGCATAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD