Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FdsR in Burkholderia

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Regulog: FdsR - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia vietnamiensis G4
Bcep1808_0954 fdsG -131 5.7 TTATGTACTCCGATTTCCTAT
Bcep1808_0954 fdsG -44 4.7 ATATGAATTACCGGCACATAT
Bcep1808_0955 fdsR -108 4.7 ATATGTGCCGGTAATTCATAT
Bcep1808_0955 fdsR -21 5.7 ATAGGAAATCGGAGTACATAA
Burkholderia cepacia AMMD
Bamb_0897 fdsG -44 5.3 ATATGCATTCCTAGCGCATAT
Bamb_0897 fdsG -131 6 TTATGCACTCCGATTTCCTAT
Bamb_0898 fdsR -108 5.3 ATATGCGCTAGGAATGCATAT
Bamb_0898 fdsR -21 6 ATAGGAAATCGGAGTGCATAA
Burkholderia glumae BGR1
bglu_1g08600 fdsG -127 5.3 TTATGCAACCTCATTTCTTAT
bglu_1g08610 fdsR -21 5.3 ATAAGAAATGAGGTTGCATAA
Burkholderia mallei ATCC 23344
BMA0448 fdsG -44 4.7 ATATGAATCATAAGCGCATAT
BMA0448 fdsG -130 5.7 TTATGCAATTCCGTTTCCTAT
BMA0446 fdsR -93 5.7 ATAGGAAACGGAATTGCATAA
BMA0446 fdsR -179 4.7 ATATGCGCTTATGATTCATAT
Burkholderia phymatum STM815
Bphy_0729 fdsG -134 5 ATATGCTGTTGTAGTTCCTAT
Bphy_0729 fdsG -44 5.3 TTATGAATAACAAGTGCATAT
Bphy_0730 fdsR -21 5 ATAGGAACTACAACAGCATAT
Bphy_0730 fdsR -111 5.3 ATATGCACTTGTTATTCATAA
Burkholderia pseudomallei K96243
BPSL2527 fdsR -21 5.7 ATAGGAAACGGAATTGCATAA
BPSL2528 fdsG -88 5.7 TTATGCAATTCCGTTTCCTAT
BPSL2527 fdsR -107 4.7 ATATGCGCTTATGATTCATAT
Burkholderia sp. 383
Bcep18194_A4146 fdsG -131 6 TTATGCACTCCGATTTCCTAT
Bcep18194_A4146 fdsG -44 5.2 ATATGAATCTCGAGCGCATAT
Bcep18194_A4147 fdsR -108 5.2 ATATGCGCTCGAGATTCATAT
Bcep18194_A4147 fdsR -21 6 ATAGGAAATCGGAGTGCATAA
Burkholderia xenovorans LB400
Bxe_A0966 fdsG -43 5.3 TTATGAATGACAAGTGCATAT
Bxe_A0967 fdsR -112 5.3 ATATGCACTTGTCATTCATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD