Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FdsR in Pseudomonadaceae

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Regulog: FdsR - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas mendocina ymp
Pmen_0387 fdsG -124 6 ATAAGAACTTTACTTCATAT
Pmen_0387 fdsG -200 5.6 ATATGTTCAAGGATTCATAT
Pmen_0386 fdsR -94 6 ATATGAAGTAAAGTTCTTAT
Pmen_0386 fdsR -18 5.6 ATATGAATCCTTGAACATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD