Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FdsR in Oceanospirillales/Alteromonadales

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Regulog: FdsR - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Marinobacter sp. ELB17
MELB17_23345 fdsR -103 6 ATATGCATAATTGTTCCTAC
MELB17_23340 fdsG -103 5.8 TTATGCAATTTTATTCATAT
MELB17_23340 fdsG -12 6 GTAGGAACAATTATGCATAT
MELB17_23345 fdsR -12 5.8 ATATGAATAAAATTGCATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD