Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FdsR in Alcaligenaceae

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Regulog: FdsR - Alcaligenaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bordetella avium 197N
BAV0819 fdsR -82 5.9 ATATGTTTATTTTTACATAT
BAV0818 fdsG -145 5.9 ATATGTTATTTCTTGCATAT
BAV0818 fdsG -65 5.9 ATATGTAAAAATAAACATAT
Bordetella bronchiseptica RB50
BB1324 fdsR -88 6.1 ATATGTTATTCAGTACATAT
BB1323 fdsG -81 6.1 ATATGTACTGAATAACATAT
BB1323 fdsG -158 5.6 ATATGTCATTTATTTCTTAT
Bordetella petrii DSM 12804
Bpet3683 fdsG -95 6.1 ATATGTTTTTAACAGCATAT
Bpet3682 fdsR -88 6.1 ATATGCTGTTAAAAACATAT
Bpet3683 fdsG -172 5.8 ATATGTCATTAATTTCTTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD