Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FdsR in Comamonadaceae

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Regulog: FdsR - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Methylibium petroleiphilum PM1
Mpe_A3707 fdsR -28 5.8 ATATGCGCTGAAGCGCCGAA
Mpe_A3708 fdsG -167 5.8 TTCGGCGCTTCAGCGCATAT
Variovorax paradoxus S110
Vapar_3016 fdsR -24 5.8 ATATGCTTTGGAAAGCCGAA
Vapar_3017 fdsG -119 5.8 TTCGGCTTTCCAAAGCATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD