Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FdsR in Ralstonia

Properties
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Regulog: FdsR - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Cupriavidus taiwanensis
RALTA_A0597 fdsG -163 5.6 ATATGTAGAAAATAGCTTAT
RALTA_A0597 fdsG -77 5.7 ATAGGAAAAAAATAGCATAT
RALTA_A0596 fdsR -104 5.7 ATATGCTATTTTTTTCCTAT
RALTA_A0596 fdsR -18 5.6 ATAAGCTATTTTCTACATAT
Ralstonia eutropha H16
H16_A0640 fdsG -65 5.7 ATAGGAAAAAAATAGCATAT
H16_A0639 fdsR -105 5.7 ATATGCTATTTTTTTCCTAT
H16_A0640 fdsG -152 5.6 ATATGTAGAAAATAGCTTAT
H16_A0639 fdsR -18 5.6 ATAAGCTATTTTCTACATAT
Ralstonia eutropha JMP134
Reut_A0616 fdsR -18 5.5 ATAAGCTATTTTGTTCATAT
Reut_A0616 fdsR -105 5.7 ATATGCTATTTTTTTCCTAT
Reut_A0617 fdsG -149 5.5 ATATGAACAAAATAGCTTAT
Reut_A0617 fdsG -62 5.7 ATAGGAAAAAAATAGCATAT
Ralstonia metallidurans CH34
Rmet_0552 fdsR 12 5.7 ATATGCTATTTTCCGCATAT
Rmet_0553 fdsG -145 5.7 ATATGCGGAAAATAGCATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD